ID: 1093843479

View in Genome Browser
Species Human (GRCh38)
Location 12:23936250-23936272
Sequence GTTTTAAAGAAGTTTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 431}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093843479_1093843482 8 Left 1093843479 12:23936250-23936272 CCCTCCACAAACTTCTTTAAAAC 0: 1
1: 0
2: 0
3: 37
4: 431
Right 1093843482 12:23936281-23936303 AAAATTAAAGATACATATAGTGG 0: 1
1: 0
2: 7
3: 77
4: 928

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093843479 Original CRISPR GTTTTAAAGAAGTTTGTGGA GGG (reversed) Intronic
900230922 1:1557098-1557120 GTTTTAAAATAGTTTTGGGAAGG - Intronic
901067900 1:6503114-6503136 GTTTTAAAGAGCTTTGAGGCTGG + Intronic
903806514 1:26009568-26009590 ATTGAAAAGAAGTTTGTGGCAGG + Intergenic
903844059 1:26266465-26266487 ATTTTAAAGATGTTTTTGGAAGG + Intronic
904278753 1:29403194-29403216 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
904944330 1:34188283-34188305 GTTTCAAAGAAAAGTGTGGAAGG + Intronic
905036561 1:34922205-34922227 ATATGAAAGAAGTTTGTGGAGGG - Intronic
906814797 1:48867680-48867702 GTTAAAAAGAAGTATCTGGAGGG - Intronic
907545711 1:55258309-55258331 GTTTTGTAGAACTTGGTGGAAGG - Intergenic
908054083 1:60264349-60264371 GTTTGTAAGAAGTTAGGGGAAGG - Intergenic
908576437 1:65465176-65465198 CTTTTAAAGCAGTGTGTAGAGGG - Intronic
909297719 1:73971693-73971715 GTTTTAAAGAGTTTTGTGCCAGG + Intergenic
909534954 1:76726191-76726213 GTTTTAAGTAAGATTGTGGATGG - Intergenic
909770644 1:79417132-79417154 CATTTAAAGAAGTGTGTAGAGGG + Intergenic
909841494 1:80332664-80332686 GTATTAAAGAACTTAGTGAAGGG + Intergenic
910184593 1:84524323-84524345 GTTGTAAAGTCGTTTGTTGAAGG + Intergenic
910261801 1:85300119-85300141 GAATTAAAGGAGTTGGTGGATGG + Intergenic
910341196 1:86189933-86189955 GTTTTATAGTTGTTTGTGGCAGG + Intergenic
910403009 1:86855794-86855816 GTTTAAAACAAGCTTGTGGCCGG - Intergenic
910558588 1:88565237-88565259 CTTTTATAGAAATGTGTGGATGG + Intergenic
910612231 1:89157194-89157216 CATTTAAAGAAGTGTGTAGAGGG + Intronic
910696980 1:90029522-90029544 TTTTTAAAAATATTTGTGGAAGG + Intronic
911997450 1:104785073-104785095 ATTTTAAATAATTTTGTGTATGG - Intergenic
913080954 1:115386472-115386494 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915851214 1:159325796-159325818 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
915957182 1:160231052-160231074 GTTTTAAAGAAGTTAGATGATGG - Intronic
916334499 1:163655180-163655202 GCTTTCAAGAAATTTGTGCAAGG - Intergenic
917655490 1:177121661-177121683 GCCTTAAAGAAGTTGGAGGAAGG - Intronic
918157552 1:181864087-181864109 ATTTTAAGAAAGTTTCTGGAAGG - Intergenic
918265104 1:182834907-182834929 TTTCTAAAGTAGTTTGTAGAGGG + Intergenic
918830987 1:189398276-189398298 GTGCTGAAGAAGTCTGTGGAAGG + Intergenic
918892883 1:190298390-190298412 TTTTTAAAGATCTTTGAGGAGGG + Intronic
919399589 1:197095369-197095391 GTTTTAAAGATGGTTTAGGAAGG - Intronic
919981196 1:202643756-202643778 GTCCTACAGAAGTTTGAGGAGGG + Intronic
920169925 1:204065549-204065571 ATTTAAAAAAAGTTTGGGGATGG + Intergenic
920202922 1:204271094-204271116 GTTTTAAGAAAGTTTGTGTTGGG - Intronic
920415669 1:205797839-205797861 TTTAAAAAGAAGTCTGTGGAAGG + Intronic
922996769 1:229970489-229970511 GATAAAAAGAATTTTGTGGATGG + Intergenic
923184277 1:231555029-231555051 ATTTTTAAAAAGTTTGTTGAGGG + Intronic
923852013 1:237806378-237806400 GTTTTAAAGATTTTTTTGAAGGG + Intronic
1063694060 10:8316045-8316067 TTTTCAAAAAAGTCTGTGGATGG - Intergenic
1064683921 10:17839502-17839524 CTTTTAAAGAATTTTTTTGAAGG + Intronic
1065656951 10:27961423-27961445 GTTTTATCTAAGTTTGTGCAGGG - Intronic
1066128616 10:32367336-32367358 GTTTTAAAAAAGTTTGGGGCCGG - Intronic
1066335875 10:34478054-34478076 CTTTGGAAGAAATTTGTGGAAGG + Intronic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068562594 10:58532268-58532290 ATCTTCAAAAAGTTTGTGGACGG + Intronic
1069316881 10:67115709-67115731 CTTTTAAAGAAATTTGTGATAGG + Intronic
1070469077 10:76760010-76760032 GGTTGAAGGAAGTTAGTGGATGG - Intergenic
1071838847 10:89447597-89447619 CATTTAAAGAAGTGTGTAGAGGG + Intronic
1072132876 10:92513502-92513524 GTTTTTAAAAATTTTGTGGGGGG + Intronic
1073968307 10:109016811-109016833 GACTTAAAGAATTTTGTGGAGGG + Intergenic
1074000773 10:109370223-109370245 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1075312821 10:121429225-121429247 ATTTTAGAGAAGTTTTTGAAGGG + Intergenic
1075914116 10:126151600-126151622 TTTTTAAAGGAGGGTGTGGAAGG - Intronic
1076148805 10:128146685-128146707 GTTTTAAAGTTGTTGGTGGGAGG - Intergenic
1076578169 10:131485584-131485606 ATTTTAAAAAATTATGTGGAAGG + Intergenic
1076758594 10:132588707-132588729 GTTTTAAGGAAGTCTTTGGAAGG + Intronic
1078272113 11:9805535-9805557 GCTTTGAAGACTTTTGTGGAGGG + Intronic
1078648717 11:13167202-13167224 GTTTTAAAGAAGCTAGTGAGGGG - Intergenic
1078983721 11:16568062-16568084 ATTTTAAATAATTTTGTGCATGG - Intronic
1080618614 11:33967838-33967860 GTTTTAAGGAAGGTGGTGAATGG - Intergenic
1080904564 11:36528483-36528505 TGTTTAAAGAAGTGTGTAGAGGG + Intronic
1081028712 11:38049873-38049895 GTTTTTAGGAAGTTTATGTAAGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081151177 11:39634541-39634563 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1081335525 11:41861297-41861319 GTTTTAAGTAAGTTTGTGCAAGG - Intergenic
1082136235 11:48552507-48552529 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1082850853 11:57763410-57763432 GTCTTAAAAAAATTTGTGGCAGG - Intronic
1082967916 11:58987069-58987091 CATTTAAAGTAGTGTGTGGAGGG - Intronic
1083503623 11:63134400-63134422 GATTCAAAGAAGTTTCAGGAAGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084511473 11:69607358-69607380 GTTTTAGAGTTGTTTGTGGCAGG - Intergenic
1085819458 11:79776714-79776736 GTTTTAATGAAATTTGTCAAAGG + Intergenic
1086177970 11:83915087-83915109 GTTTAAAAAAAGTTTTAGGAAGG + Intronic
1086230131 11:84558583-84558605 GATTTAAGGCAGTTTGTAGAGGG - Intronic
1086567863 11:88247115-88247137 CATTTCAAGAACTTTGTGGAAGG + Intergenic
1086691545 11:89792734-89792756 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1086811773 11:91319441-91319463 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1088937317 11:114416433-114416455 TTTTTCTAGAAGTTTGTGGTTGG - Intronic
1089078943 11:115760431-115760453 GTTTTGCAGAAGTTTGCTGAGGG + Intergenic
1091437244 12:482145-482167 GGTATAAAGAGGTTTGTGGTTGG + Intronic
1091702299 12:2671896-2671918 GATTTTAACAAGTTTATGGAGGG - Intronic
1091702313 12:2671960-2671982 GATTTTAACAAGTTTGTGGAGGG - Intronic
1092532657 12:9358144-9358166 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1093559374 12:20519998-20520020 GATTTAAAGAAGTTTGCCTAAGG + Intronic
1093843479 12:23936250-23936272 GTTTTAAAGAAGTTTGTGGAGGG - Intronic
1094285357 12:28786758-28786780 GTTTTTAAGTAGTTTATGCAAGG + Intergenic
1094691608 12:32774902-32774924 GTTTTTAAAAAGTTTTTAGATGG + Intergenic
1095878323 12:47105751-47105773 GCTTTAATGCTGTTTGTGGAAGG + Intronic
1096234765 12:49918580-49918602 GGTCTAAAGAAGTTAGTGGTGGG - Intergenic
1097343402 12:58465336-58465358 GTATTAAAGAGGTCTGTAGAAGG + Intergenic
1097548257 12:61032352-61032374 GTTAGAAAGAAGGTTGTGGGAGG - Intergenic
1097830446 12:64218866-64218888 GTTTGAAAGAAATGTGTTGATGG - Intronic
1097927917 12:65150933-65150955 GTTTTTAAGAAGGTCCTGGAAGG - Intergenic
1098115946 12:67176791-67176813 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1098530461 12:71535864-71535886 GTTTTAAATCAGTGTGTGTAGGG - Intronic
1098896016 12:76061712-76061734 GATTTACAAAAGTTTGTGGCAGG - Intronic
1099113240 12:78588446-78588468 ATTTTAAAGAAATTTGTCCATGG - Intergenic
1102103420 12:110299496-110299518 TTTTTAAAAAAGTTTTTGGCAGG + Intronic
1103759802 12:123240541-123240563 GTTTTAATGAAGTTTCTGCAAGG + Intronic
1104503829 12:129311656-129311678 GTTGTGAAGAAGTTGGTGGTGGG + Intronic
1104865890 12:131953810-131953832 GATTGAAAGAATTTTGTGGTTGG + Intronic
1104888893 12:132129908-132129930 GTTTTAAAAAAGTTAATGGAAGG + Intronic
1106282748 13:28290330-28290352 GTTTTAAGGAAGTTAAAGGAAGG - Intronic
1106608376 13:31253202-31253224 CATTTAAAGAAGTGTGTAGAGGG + Intronic
1106768198 13:32937155-32937177 GATTCACAGAGGTTTGTGGAGGG - Intergenic
1108291014 13:48961149-48961171 GTTTTAAGTAAGTTTAGGGATGG + Intergenic
1109799739 13:67361394-67361416 GTTATATAGAAGTTTCTGTATGG + Intergenic
1109816490 13:67591363-67591385 CATTTAAAGAAGTGTGTAGAGGG + Intergenic
1110349682 13:74492809-74492831 GATTTAAAGCAGTGTGTAGAGGG - Intergenic
1111037397 13:82694721-82694743 GTTCTAAATAAGTATTTGGATGG - Intergenic
1111126543 13:83916478-83916500 AATTTAAGGAAGTTTTTGGAGGG + Intergenic
1112962396 13:105142842-105142864 TTTTTAAAGAAGTTTTGGGGTGG + Intergenic
1113106118 13:106773121-106773143 TTTTTCAATAAGTTTGTGTATGG - Intergenic
1114030031 14:18570231-18570253 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1114163509 14:20195241-20195263 GTTTTAAAAAATTATGTGGCTGG + Intergenic
1114472282 14:22971853-22971875 TTTTTAAAAAAGTTTTTGAATGG + Exonic
1114708851 14:24756387-24756409 CATTTAAAGCAGTGTGTGGAAGG + Intergenic
1115127976 14:30018984-30019006 GTGTTACAGAAGTTGGAGGAGGG - Intronic
1115624609 14:35177896-35177918 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1115789710 14:36865274-36865296 TTTTTAATAAAGTTTGTGGTGGG + Intronic
1115951250 14:38724665-38724687 CCTTTAAAGAACTTTGTGAAAGG - Intergenic
1115994555 14:39182740-39182762 GTTTTCAAGAATTTTGTTTAAGG + Exonic
1116360692 14:43993100-43993122 TTTTTAAAGCAATTTGGGGAAGG - Intergenic
1116723977 14:48537093-48537115 GTTTTAGTGAAGTTTGGGGAAGG + Intergenic
1117140583 14:52787006-52787028 ATTTTAAATAATTTTGTGCATGG + Intronic
1117290913 14:54331707-54331729 GTTTTAAACAACTTTTTGAAAGG - Intergenic
1117529206 14:56642498-56642520 CATTTAAAGCAGTGTGTGGAGGG + Intronic
1118473630 14:66097674-66097696 GAATGAAAGAGGTTTGTGGAAGG + Intergenic
1119149842 14:72348661-72348683 GTTTTAAAATAGATGGTGGATGG + Intronic
1120619648 14:86748181-86748203 AATTTAAAGAAGTGTGTAGAGGG - Intergenic
1121435129 14:93914173-93914195 CTTTTAAAAATGTTTCTGGAGGG - Intergenic
1121765115 14:96479397-96479419 TTTTTAAAGAAATGTGTGTATGG + Intronic
1122012688 14:98764822-98764844 GTTTTAAAGAAGTTAATGTAAGG + Intergenic
1122082253 14:99274070-99274092 GTCTTAAAGAAGTTTATTAAAGG - Intergenic
1122697792 14:103565316-103565338 GTTTTAAAGATGGATTTGGAAGG - Intronic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1123975010 15:25545076-25545098 GATTAACAAAAGTTTGTGGATGG + Intergenic
1124213573 15:27785046-27785068 GGTTTTCAGAAGTTTGTGTATGG - Intronic
1124496889 15:30192486-30192508 GTCCTACAGAAGTTTGAGGAGGG + Intergenic
1124746687 15:32346161-32346183 GTCCTACAGAAGTTTGAGGAGGG - Intergenic
1125391004 15:39192907-39192929 GTTATAACGATGGTTGTGGATGG - Intergenic
1125451353 15:39810985-39811007 GGTTTAAAGAATTGTGTGAAGGG + Intronic
1126239748 15:46427900-46427922 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
1127808664 15:62544205-62544227 CTTTTAAAAAATATTGTGGAAGG + Intronic
1128873771 15:71185119-71185141 GTTTTAAAGAAGTTGGTCTTAGG - Intronic
1130106811 15:80934963-80934985 GTTGACAAGAAGCTTGTGGAAGG + Intronic
1130312566 15:82767971-82767993 GGTTTACAGAAGTTTGTGAAAGG - Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131125082 15:89853092-89853114 GTTTTGAGGAAGGTGGTGGAGGG + Intronic
1131518148 15:93093117-93093139 GTTTTAAAAAAATGTGTGAAGGG + Intergenic
1133653534 16:7835977-7835999 GTTTTTAGGAAGATTTTGGAGGG + Intergenic
1137563713 16:49520207-49520229 GTTTGAAGCAAGTATGTGGAGGG - Intronic
1137641589 16:50035884-50035906 GTTTTAAAGAGCTGTGGGGATGG - Exonic
1138621685 16:58216461-58216483 GTTTTAAACACATTTTTGGAAGG + Intergenic
1140390575 16:74583101-74583123 GTTGGAAAGAGGCTTGTGGAGGG - Intronic
1140494000 16:75367253-75367275 GTTTTAAACAGGTTTTTGGGTGG - Intronic
1140924839 16:79572249-79572271 TTTTCAAAGAGGTGTGTGGAGGG + Intergenic
1141281193 16:82631213-82631235 ATTTCAAAGATGTTTGTAGACGG + Intronic
1141460478 16:84176092-84176114 TTTTTAAAGATGTCTGTGAAGGG - Exonic
1142418451 16:89955774-89955796 TTTTTAAAAAAGTTTGAGGCCGG + Intronic
1142500542 17:330434-330456 GATTTAAAGTTGTTTGAGGACGG - Intronic
1144069742 17:11659033-11659055 TTTCTGAAAAAGTTTGTGGAAGG + Intronic
1144122098 17:12165223-12165245 ATTTTGAAGAACTTTGGGGAAGG - Intergenic
1144544003 17:16175450-16175472 GTTTTAAAGATGTTTAAAGATGG - Intronic
1144911903 17:18689747-18689769 GTTTTAAGAAAATTTGTGGCCGG + Intergenic
1145408598 17:22634390-22634412 GTTATAAACAACTTTCTGGAAGG + Intergenic
1146438738 17:32876056-32876078 TTTTTCAAGGAGTTAGTGGATGG - Intronic
1147038126 17:37697039-37697061 ATTTTAAAGATGGTAGTGGAAGG + Intronic
1148216954 17:45838459-45838481 GTTATAAGGATGTTTGTGGATGG - Intergenic
1148321370 17:46756864-46756886 TTTTGGAAGAAGTGTGTGGAGGG - Exonic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1151244810 17:72786211-72786233 GTTTTCCATATGTTTGTGGATGG - Intronic
1155905940 18:31451390-31451412 TTTTTAAAGAAGTTGGTGGTAGG + Intronic
1156005953 18:32441588-32441610 GTTTAAAAGATGTTTGTGTCTGG - Intronic
1156816279 18:41315449-41315471 GTTTTTAAGAATATTTTGGAAGG - Intergenic
1157690402 18:49677284-49677306 TTTTTAAAGAGGTTCGTGGTGGG - Intergenic
1158630150 18:59106223-59106245 ATTTTTAAGAAGTTCCTGGAAGG + Intergenic
1158950052 18:62486106-62486128 ATTTTAAAGAGGTTTGCTGAGGG + Intergenic
1159199814 18:65169356-65169378 CATTTAAAGAAGTGTGTAGAGGG + Intergenic
1159827814 18:73236396-73236418 GTTTTAAAGCAGTTTTGGGTAGG + Intronic
1159984348 18:74824202-74824224 CATTTAAAGAAGTGTGTAGAGGG + Intronic
1160250242 18:77197195-77197217 GTTTTAAAGAAGGTGGGGAAGGG + Intergenic
1162106391 19:8372353-8372375 ATTATAAAGATGTTTGTGGCCGG - Intronic
1162628763 19:11908661-11908683 CATTTAAAGCAGTTTGTAGAGGG + Intronic
1163735434 19:18977417-18977439 GTTTTTAAAAAGTTTGGGCATGG - Intergenic
1164248354 19:23454899-23454921 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1164536838 19:29092457-29092479 GTTTTAAAAATGTTGGTGAAGGG - Intergenic
1165653407 19:37510991-37511013 TTTTTAAAGAATTTTTTGGCCGG - Intronic
1166156461 19:40915658-40915680 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1166581970 19:43909037-43909059 GTTTTAAAGGCTTTTGTGTAGGG - Intergenic
924982043 2:232371-232393 GATTTTCAGATGTTTGTGGAAGG - Intronic
925501059 2:4505341-4505363 GTTTTAAGGATGTGTATGGATGG + Intergenic
925792114 2:7500702-7500724 GTTTTGAAGAAATTAATGGATGG + Intergenic
927014359 2:18942085-18942107 GTTTAAAAGAATGTTGTGGCTGG + Intergenic
927447253 2:23174509-23174531 CATTTAAAGAAGTGTGTAGAGGG + Intergenic
928866813 2:35927085-35927107 GAAATAAAAAAGTTTGTGGAGGG + Intergenic
929039141 2:37726127-37726149 CATTTAAAGCAGTGTGTGGAGGG + Intronic
929211116 2:39358742-39358764 GATTTAAAGAACTTTGTTCAAGG + Intronic
929354705 2:41006881-41006903 TTCTTAAAGAATTTTGTGGCAGG - Intergenic
930123552 2:47779423-47779445 CTTTTAATGAAGTTTGTGGGAGG + Intronic
930233023 2:48861689-48861711 GTTTTAAAGAAAGTTGGGAAAGG - Intergenic
930295212 2:49545567-49545589 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
930860065 2:56062808-56062830 CATTTAAAGCAGTATGTGGAGGG - Intergenic
931834462 2:66084360-66084382 GGTTTTTAGAAGTCTGTGGAGGG - Intergenic
934490580 2:94759824-94759846 GTTTTAGAGATGACTGTGGAAGG - Intergenic
935082195 2:99809160-99809182 ATATGAAAGAAGTTTCTGGAAGG + Intronic
935677463 2:105608381-105608403 GTATTAATAAAGTTGGTGGATGG - Intergenic
935822894 2:106912162-106912184 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
938686770 2:133745849-133745871 TTTTTAAAGATGTTGATGGAGGG - Intergenic
939328375 2:140725201-140725223 CTTTTAAAGATATTTTTGGAGGG + Intronic
942273313 2:174299131-174299153 TTTTTAAAAAATTTTTTGGAGGG + Intergenic
942958458 2:181801701-181801723 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
942994753 2:182247816-182247838 TTTTGAAAGAAATTTGTGCAAGG + Intronic
943180653 2:184536484-184536506 TTTTTAAAGAATTTTGAGGCAGG + Intergenic
943688642 2:190845737-190845759 TTTTTCAACAAGTTTGTGGAGGG - Intergenic
944109966 2:196121565-196121587 GTTTTAAAAATGTTTTAGGATGG - Intergenic
944320374 2:198333432-198333454 ATTTTCAAGATATTTGTGGAAGG - Intronic
944448154 2:199813154-199813176 GGTTTAAAGATGCTTGTGGTAGG + Intronic
944893150 2:204137971-204137993 GTTTTAAAGAACTTTGTAGCTGG - Intergenic
945161588 2:206897360-206897382 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
945622315 2:212155999-212156021 TTTTTAAATATGTTTCTGGATGG + Intronic
945773405 2:214074449-214074471 TTTTTAAAGAAGATAATGGAAGG + Intronic
946294107 2:218769811-218769833 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
946805519 2:223467323-223467345 TTTTTAAGGAACTGTGTGGAAGG + Intergenic
1170494351 20:16910580-16910602 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1170781052 20:19425732-19425754 AATTTAAAGAAGTGTGTGGTGGG - Intronic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171497699 20:25568705-25568727 GTTTTTAAGAAATTGGTGGCAGG - Intronic
1172510660 20:35498670-35498692 GTCTTGATGAAGCTTGTGGAGGG - Exonic
1173986186 20:47263342-47263364 GCTGGAAAGAAATTTGTGGATGG + Intronic
1175071721 20:56339755-56339777 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1175739202 20:61408804-61408826 CTTTTACAGATGTTTATGGAAGG + Intronic
1178011973 21:28298159-28298181 GTTTTCAAGAAGTTTTGGCAAGG - Intergenic
1178753121 21:35323084-35323106 CATATAAAGAAGTTGGTGGAAGG + Intronic
1179360731 21:40705886-40705908 GTTAGAAAGCAGTTTGTGGCCGG + Intronic
1180253482 21:46605790-46605812 GTTTTACAGAGGCGTGTGGACGG + Intergenic
1180454146 22:15497281-15497303 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1183144695 22:35979351-35979373 ATGTTAACGAAGTCTGTGGATGG + Intronic
1183796548 22:40123168-40123190 GATTTTAAGAAGTGAGTGGAGGG + Intronic
1184017521 22:41797287-41797309 GTTTTAAATAATTTTGTTCATGG - Intronic
1184697671 22:46149346-46149368 GTTTAAGAGAAGTTTGTGAAAGG + Intergenic
949450289 3:4177529-4177551 CATTTAAAGAAGTGTGTAGAGGG + Intronic
950226863 3:11242804-11242826 GACTTAAAGAAGTTTGAGGTAGG - Intronic
950450825 3:13064361-13064383 GTTTTAAATATGTGTGTGGATGG - Intronic
950590651 3:13933968-13933990 GTTTTAAAGATTCTGGTGGAGGG + Intergenic
950711832 3:14818785-14818807 GTTTTAAAGATTCTGGTGGAGGG + Intergenic
951120795 3:18925370-18925392 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
951606635 3:24441833-24441855 CTTTTAAAAATGTTTTTGGATGG - Intronic
951627464 3:24681422-24681444 TTTACAAAGATGTTTGTGGAAGG + Intergenic
951753734 3:26066411-26066433 CTTTTCTAGATGTTTGTGGAGGG - Intergenic
951913068 3:27771494-27771516 TTTTTAAAGAAAATTGTGGCTGG + Intergenic
952068978 3:29609722-29609744 GATTGAAAGAGGTTTGTAGAAGG + Intronic
953637839 3:44677726-44677748 GATTTACAGAGGTTTGGGGAGGG + Intergenic
954916119 3:54149777-54149799 GATTTAAAGAAGTTTGGTTAGGG + Intronic
955012274 3:55029885-55029907 GTTTTAAACAAGATTGAGTATGG - Intronic
956201996 3:66716161-66716183 GTTTTAGAGGCTTTTGTGGAAGG - Intergenic
956345781 3:68276783-68276805 TTTTTAAAATAGTTTGTGGAGGG + Intronic
957864551 3:86005253-86005275 TTTTTAAATAATTTTGTGGCCGG + Intronic
958625929 3:96624331-96624353 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
958713729 3:97752181-97752203 GTTTTAAAGCTGTTGCTGGAAGG - Intronic
958720711 3:97839484-97839506 GTTTTAGAGAAGTATGTTGTAGG + Intronic
959604440 3:108226724-108226746 ATTTTAAAGAAGTCTGAGGTAGG + Intergenic
959763733 3:109999551-109999573 ATTTTAAAGCAGTGTGTAGAGGG - Intergenic
960079363 3:113524900-113524922 CCTTTACAGAAGTTTGTGGGTGG + Intergenic
960184572 3:114623219-114623241 GTTATTAAGAAGGATGTGGAAGG + Intronic
960603283 3:119479224-119479246 TTTTGAAAGAAGTTTGAGGTTGG - Intronic
961861362 3:129919044-129919066 GTTATTAAGAAGTTTGAGGGAGG + Intergenic
963976602 3:151486824-151486846 GATTTAAAGCAGTGTGTAGAGGG + Intergenic
966474078 3:180323959-180323981 GATTTGAAGAAGCTTGTGGGAGG + Intergenic
966596391 3:181727554-181727576 GTAGTAAAGAAGTTTTGGGAGGG + Intergenic
967272317 3:187741748-187741770 GTGTTGAGGAGGTTTGTGGATGG - Intronic
967514924 3:190356551-190356573 GTTTTAAATCAGATTGAGGAAGG - Intronic
970282238 4:14470403-14470425 TTTTTAAAGAAGCCTATGGAAGG + Intergenic
970847390 4:20556959-20556981 GTTTAAAGGAATTTTGTGGCTGG - Intronic
971396136 4:26229221-26229243 GTTCTACAGATGTTTGTGAAGGG + Intronic
971559736 4:28062650-28062672 GTTTTGCAGAAGTTGGAGGAAGG - Intergenic
972196441 4:36659017-36659039 GATTTAAAGCAGTGTGTAGAGGG + Intergenic
972574885 4:40342727-40342749 TTTTGAAAGCAGTGTGTGGAAGG + Intronic
972697784 4:41464803-41464825 GGTTTGAGGAAGCTTGTGGAGGG - Intronic
972859590 4:43151091-43151113 CTTTTAAAGTAGTGTGTAGAAGG - Intergenic
972914574 4:43859968-43859990 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
974231478 4:59121154-59121176 GTATTAAATATGTTTGTGAATGG - Intergenic
974284350 4:59844787-59844809 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
974866033 4:67581686-67581708 GTTCTAAAGATGTGGGTGGAAGG - Intronic
974984003 4:68995941-68995963 ATTTTAAAGAAATTTTTAGAAGG - Intergenic
975804704 4:78099711-78099733 GTTCCAGAGTAGTTTGTGGAGGG + Intronic
976263349 4:83167033-83167055 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
976760331 4:88541936-88541958 CATTTAAAGCAGTGTGTGGAGGG + Intronic
978327738 4:107578183-107578205 CTTTTAAAAAAGTCTGTGTAAGG - Intergenic
978674583 4:111296033-111296055 GATTCAAAGAAGCTTGTGAAAGG + Intergenic
978836159 4:113151759-113151781 ATTTTAAAGAAATTTGGTGAAGG + Intronic
979538391 4:121850741-121850763 GTTTTAAAGGAGGGAGTGGAAGG + Intronic
979834654 4:125349384-125349406 GTTTCAAATGAGTTTGTGAATGG + Intronic
981550099 4:145935452-145935474 TTTTTAAAGCAGTTTGTGTTTGG - Intronic
981795982 4:148596117-148596139 CATTTAAAGTAGTGTGTGGAGGG - Intergenic
981833302 4:149026979-149027001 GTTTTTAAAAAGTGTGTGGGAGG + Intergenic
981879704 4:149594607-149594629 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
982461364 4:155673417-155673439 GTTTTAAAGAAGTTAGGAGAAGG + Intronic
982568663 4:157020880-157020902 GTTTTAAAGAAATGTGTGATTGG - Intergenic
982643828 4:157997227-157997249 TTTTTAAAGAAACTTTTGGAAGG - Intergenic
983346321 4:166529626-166529648 GTTTTACAGCAGTTTGTTGTAGG - Intergenic
983694156 4:170508240-170508262 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
983991486 4:174125304-174125326 GTGTGAAAGAATTTTGGGGATGG - Intergenic
984186980 4:176556900-176556922 GTTTTAAAGTTGTTTATGGCAGG - Intergenic
984348623 4:178563718-178563740 GCTTCAAACAAGTTTATGGAAGG - Intergenic
984379602 4:178974408-178974430 ATTTTAAAGATGTTTGTAGGTGG + Intergenic
984451076 4:179903241-179903263 CTATTAAAGAAATTTGTGCAAGG + Intergenic
986462347 5:7984445-7984467 GTTTTAAGGAAGTTTCTGGTAGG + Intergenic
987006856 5:13719422-13719444 GTTTTAATGGAATTTGGGGAGGG - Intronic
987334617 5:16887824-16887846 GTTTTAAGGAATTGTGAGGAAGG - Intronic
987565086 5:19574078-19574100 TTTTCAATGAAATTTGTGGAGGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989676835 5:43982579-43982601 TTTAGAAAGAAGTATGTGGATGG - Intergenic
990087858 5:52000873-52000895 GTGTAAAATAAGTTTGGGGATGG + Intergenic
990643016 5:57809574-57809596 ATTTTAAAGATGGTGGTGGAAGG - Intergenic
991199734 5:63978048-63978070 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991553473 5:67869120-67869142 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
992740866 5:79772134-79772156 GTCTTAATGAAATTGGTGGATGG - Intronic
993164876 5:84339513-84339535 CTCTTAAGGAAGTTTGTGTAAGG + Intronic
993540345 5:89141561-89141583 GTTTTTAAGAAGGTTGTGAAAGG + Intergenic
993803672 5:92376228-92376250 GCTTTAAAGTAGCTTTTGGAAGG + Intergenic
994407749 5:99366670-99366692 CTTTTAAAGAGGTTTCTGAATGG - Intergenic
994512212 5:100718986-100719008 TTTTTAAAAATGTTTGTGTAGGG + Intergenic
996425604 5:123310820-123310842 GATTAAAAAATGTTTGTGGATGG - Intergenic
996795918 5:127346979-127347001 ATTTTAAATAATTTTGTGTATGG + Intronic
997577214 5:134989658-134989680 GTTTTAAGGAATGTTGTGGCTGG + Intronic
998309940 5:141118974-141118996 ATTTTAAAGAAATTTGAGGCTGG - Intronic
998675851 5:144407046-144407068 CTTTTAATGAAGCTGGTGGAGGG + Intronic
999892048 5:155988678-155988700 GATTAAAAGATGTTTGTGGGAGG + Intronic
1002811616 6:636550-636572 TTTTTAAAGAGTTTTCTGGATGG + Intronic
1003502924 6:6717093-6717115 GTGCTAAAGAACTTTGTGGGGGG + Intergenic
1003551939 6:7108135-7108157 CTTTTAAAGAACTTTGGGGATGG + Intronic
1003730844 6:8821992-8822014 ATTTTAAAGGAGTATGTGGTCGG + Intergenic
1004091867 6:12511698-12511720 ATTTGAAATCAGTTTGTGGAAGG + Intergenic
1004210890 6:13642249-13642271 ATTTTACAGAAGTTTTTTGAAGG - Intronic
1007987276 6:46219274-46219296 GCTTAAAAGCAGTTTATGGATGG + Intergenic
1008209226 6:48701393-48701415 GTGCTAAAGAAGTTTCAGGAAGG - Intergenic
1008229761 6:48971178-48971200 GTTTTAAATTTGTTTATGGAAGG - Intergenic
1008254432 6:49278751-49278773 CATTTAAAGAAGTGTGTAGAAGG + Intergenic
1008817162 6:55581633-55581655 AATAAAAAGAAGTTTGTGGAAGG + Intergenic
1009395100 6:63190473-63190495 GTTTCAAAGTAGTGAGTGGAAGG - Intergenic
1009871774 6:69461554-69461576 ATTTTAAACAAGTTTGTGGGTGG + Intergenic
1010463546 6:76140933-76140955 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1011308940 6:85959899-85959921 GTTTAAAAGGAGTTTTAGGAAGG + Intergenic
1012296762 6:97533773-97533795 GTTTAAAAGCAGTTTGGAGATGG - Intergenic
1014663440 6:124203176-124203198 TTTTTAAAATAGTTTGTTGAGGG + Intronic
1014866402 6:126535782-126535804 GGTTTAAAAAAGTATTTGGAAGG + Intergenic
1014880999 6:126724311-126724333 GATTTAAAATAGTTTGAGGAAGG - Intergenic
1014907388 6:127046236-127046258 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1017968401 6:159287698-159287720 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
1018542911 6:164902405-164902427 TTTTTAAAGAAGTATATGTAGGG - Intergenic
1020708734 7:11578516-11578538 GTACTAAAGAAGTTTAGGGAAGG + Intronic
1021408042 7:20297007-20297029 GTTTTTAAAAAGTTTTTGTATGG + Intergenic
1022338905 7:29450235-29450257 GTTTTTAAGGATTTTGTGGTAGG + Intronic
1022487802 7:30793882-30793904 GTTTTCTAGAAGTTTGAAGAAGG - Intronic
1023510813 7:40951605-40951627 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
1023623324 7:42094072-42094094 GTTTAAAGGAAGTTTCAGGAAGG + Intronic
1025582664 7:62739930-62739952 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
1026053005 7:66962565-66962587 TTTTTAAAGAATTTTTTGGCTGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027426299 7:78064541-78064563 GTTTAAAAGAATTTGGTGGAGGG + Intronic
1027510021 7:79068740-79068762 AATTTAAAGCAGTGTGTGGAGGG - Intronic
1027752127 7:82162565-82162587 GTTCTTAAGAAGTTTGTAGCTGG - Intronic
1027878882 7:83806519-83806541 GTTTAAAACAAGTATGTGTATGG + Intergenic
1029810337 7:103040818-103040840 TATTTAAAGAAGTGTGTAGAGGG + Intronic
1031397117 7:121286642-121286664 GTGCTCAAGAAGTTGGTGGATGG + Intronic
1031590995 7:123592436-123592458 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1031817932 7:126462452-126462474 GTTAGATAGACGTTTGTGGATGG + Intronic
1032343516 7:131098231-131098253 GTTTAAATCAAGTTTCTGGAAGG - Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034110404 7:148531955-148531977 CTTTTAAAGCAGTGTGTAGAAGG + Intergenic
1034988309 7:155531451-155531473 GTTTTAAAACAGTGTCTGGATGG + Intronic
1035055526 7:156032622-156032644 TTTTTAAAATAGTTTGTGCAAGG - Intergenic
1035172991 7:157030395-157030417 GTTTTATAATAGTTTGGGGAAGG - Intergenic
1036961186 8:13245996-13246018 ATTTTAAAATAGTTTGTGGCTGG - Intronic
1039234573 8:35487903-35487925 GTTTTCTAGTGGTTTGTGGAAGG + Intronic
1040010930 8:42660487-42660509 CTTTTAAATGTGTTTGTGGAAGG - Intergenic
1040583099 8:48713531-48713553 GTATTAAAGAAGGTTGTTAAAGG - Intronic
1040996057 8:53403782-53403804 GTTTTAAAGAAGTTTCAGCAGGG - Intergenic
1041065944 8:54083072-54083094 GTTTTAAAGAATTTTTTCTAAGG - Intronic
1041176630 8:55203577-55203599 GGTTTGAAGAAGATTGTGGCAGG + Intronic
1041340074 8:56835630-56835652 CATTTAAAGAAGTTTGTGGGGGG - Intergenic
1041623031 8:59995495-59995517 ATTTTTCAGTAGTTTGTGGAAGG - Intergenic
1042258061 8:66826939-66826961 GTTCTTAAGAAGTTTCTGAACGG - Intronic
1043090281 8:75892824-75892846 GTTATAAAAAGGTTTGAGGAAGG + Intergenic
1043488523 8:80723427-80723449 GTTTTAGAGAAGTATGTGATTGG + Intronic
1043491580 8:80754452-80754474 ATTTTAAGAAATTTTGTGGAGGG - Intronic
1043598123 8:81907584-81907606 GTTTTCTAGTTGTTTGTGGAAGG - Intergenic
1043845117 8:85154269-85154291 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
1045070880 8:98503553-98503575 CATTTAAAGCAGTTTGTAGAGGG - Intronic
1045262366 8:100587711-100587733 ATTTTAAATAAATTTGTGCATGG - Intronic
1045462163 8:102434603-102434625 CATTTAAAGAAGTTTGTAGCAGG - Intergenic
1045480517 8:102587946-102587968 CTTTTATAGAAATTTTTGGAGGG - Intergenic
1046182439 8:110669272-110669294 GGTTTAAGGAATTTTGTGGCTGG - Intergenic
1046769881 8:118108316-118108338 GTCTCAAAGAATTCTGTGGAAGG - Intronic
1046919514 8:119713536-119713558 GTTCTAAAGATGTCTGTGGCTGG + Intergenic
1046986248 8:120391560-120391582 GTTGCACAGAAGTTTGTGCAAGG + Intronic
1049969354 9:807834-807856 AATTTACAGAAGTTTGAGGAAGG - Intergenic
1050049684 9:1586568-1586590 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
1050447545 9:5741013-5741035 CTTTTAATGAAGTTTTTTGAAGG + Intronic
1050581593 9:7062734-7062756 GTTTTAAGGGAATCTGTGGAAGG + Intronic
1052407021 9:28073875-28073897 GTTTTAAAGAACATTTTTGATGG + Intronic
1053106459 9:35413260-35413282 TATTTACAGAAGTGTGTGGAAGG - Intergenic
1053422695 9:37989798-37989820 GTTTTAAAGAGGAGTGGGGAAGG + Intronic
1053494781 9:38542152-38542174 GTTTTAGAGATGACTGTGGAAGG - Intronic
1053916989 9:42950972-42950994 GTTTTAGAGATGACTGTGGAAGG + Intergenic
1054378555 9:64465896-64465918 GTTTTAGAGATGACTGTGGAAGG + Intergenic
1054889630 9:70236988-70237010 CATTTAAAGAAGTGTGTAGAGGG + Intergenic
1055338426 9:75256846-75256868 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1055398632 9:75899737-75899759 GTATAAAGGAAGCTTGTGGAAGG + Intronic
1055412443 9:76045677-76045699 GAGTTAAAGAACTTTGTGAAGGG - Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058506448 9:105670845-105670867 GTTTTTAAGCAGTATGTGGGAGG + Intergenic
1058616784 9:106837938-106837960 GTTTTAATGATCTTTGTGTATGG - Intergenic
1058675328 9:107395321-107395343 GTTTTACAGGGGTTTTTGGATGG - Intergenic
1058817836 9:108702221-108702243 TTTTTAAATAATTTTGTGGATGG - Intergenic
1059771424 9:117430162-117430184 GTTAAAAAGAAGTGTGTGGGTGG + Intergenic
1060384013 9:123205873-123205895 TTTTAAAAGGAGTTTGTGAAAGG - Intronic
1203688460 Un_GL000214v1:18970-18992 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1203617952 Un_KI270749v1:86709-86731 TATTTAAAGAAGTGTGTAGAGGG + Intergenic
1203647815 Un_KI270751v1:85083-85105 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1185504987 X:625321-625343 GTTTCAGAGAAGTTAGTGGATGG - Intronic
1185526291 X:782845-782867 TTTTGAAAGAAGTCTGTGGCCGG - Intergenic
1186304287 X:8238304-8238326 GATTTTAATAAGTTTCTGGAAGG - Intergenic
1186950982 X:14624502-14624524 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1187275676 X:17814773-17814795 GATTCAAAGAACTTTCTGGAGGG - Intronic
1187873700 X:23785743-23785765 CTTTTATAGAAGTTGATGGATGG - Exonic
1189634373 X:42989804-42989826 ATTTTAAAGAAGTTTGGGGGAGG - Intergenic
1189820012 X:44861271-44861293 GTCTTAAAGAAGTCTGTGCTGGG - Intergenic
1190602100 X:52103727-52103749 CTTTCAAAGCAGTTTGTAGAGGG - Intergenic
1191956497 X:66647981-66648003 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1192087728 X:68117556-68117578 GATTTAAAGATGTATGTGGCTGG + Intronic
1192627846 X:72748855-72748877 GATTTAGAGTAGTTTTTGGAGGG + Intergenic
1192653862 X:72971954-72971976 GATTTAGAGTAGTTTTTGGAGGG - Intergenic
1192695017 X:73404343-73404365 CTTTTAAAGCAGTGTGTAGAGGG + Intergenic
1194324037 X:92488879-92488901 GATATAAAGAAGTTTCAGGATGG + Intronic
1195201130 X:102551251-102551273 GGTTTGCAGAAGTTTGGGGAGGG - Intergenic
1195312930 X:103651280-103651302 GTTTTAAAGAGCTGTGGGGATGG + Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195526262 X:105893472-105893494 TTTAGAAAGAAGTTTGTGCAAGG - Intronic
1195580005 X:106490965-106490987 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1195632258 X:107069833-107069855 GTTTTAGAGAGTTTTCTGGATGG - Intronic
1196476900 X:116097810-116097832 GCTTTACAGAGATTTGTGGATGG - Intergenic
1196822128 X:119710134-119710156 ATTTTAGAGAAGTTTGTTTAAGG + Intergenic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1198244260 X:134814399-134814421 CTTTAAAAGAATTTTGTGGCCGG + Intronic
1198388530 X:136150264-136150286 GCATTAAAAAAGTTTGTTGAAGG + Intronic
1198688003 X:139248378-139248400 GTTTTAAGAAAGTTTGTGTTGGG - Intergenic
1198955258 X:142122289-142122311 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1198969066 X:142260048-142260070 GCTAAACAGAAGTTTGTGGAAGG - Intergenic
1198977970 X:142358568-142358590 GAATTGAAGGAGTTTGTGGATGG - Intergenic
1199296807 X:146168671-146168693 GTGGTGCAGAAGTTTGTGGAAGG + Intergenic
1199326257 X:146502107-146502129 GTTTTAATAATGTTTGTCGATGG + Intergenic
1199803352 X:151272885-151272907 TTTTTTGAGAAGTTTGTGAAAGG - Intergenic
1199843254 X:151672114-151672136 GTGTTAAATAAGTTTCTGGGAGG + Intronic
1200632140 Y:5601972-5601994 GATATAAAGAAGTTTCAGGATGG + Intronic
1201561230 Y:15319452-15319474 CATTTAAAGAAGTGTGTAGAGGG - Intergenic
1201684543 Y:16686172-16686194 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1201919296 Y:19217103-19217125 CTTTTAAAGCAGTGTGTAGAGGG - Intergenic
1202336241 Y:23813732-23813754 GTTTCAAAGTAGTCTCTGGAAGG + Intergenic
1202534525 Y:25856335-25856357 GTTTCAAAGTAGTCTCTGGAAGG - Intergenic