ID: 1093851059

View in Genome Browser
Species Human (GRCh38)
Location 12:24038719-24038741
Sequence GTGAATAATACGAAGTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093851059_1093851062 8 Left 1093851059 12:24038719-24038741 CCTTTCAACTTCGTATTATTCAC No data
Right 1093851062 12:24038750-24038772 AGTATGTGGTAGAAAATGAGTGG No data
1093851059_1093851060 -6 Left 1093851059 12:24038719-24038741 CCTTTCAACTTCGTATTATTCAC No data
Right 1093851060 12:24038736-24038758 ATTCACTCCTGAGTAGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093851059 Original CRISPR GTGAATAATACGAAGTTGAA AGG (reversed) Intergenic
No off target data available for this crispr