ID: 1093853233

View in Genome Browser
Species Human (GRCh38)
Location 12:24066907-24066929
Sequence GAGAGAACTAACTCTACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093853231_1093853233 -2 Left 1093853231 12:24066886-24066908 CCTAAAAGTTGCCATCTTTTCGA No data
Right 1093853233 12:24066907-24066929 GAGAGAACTAACTCTACCAGTGG No data
1093853230_1093853233 5 Left 1093853230 12:24066879-24066901 CCTTTCACCTAAAAGTTGCCATC No data
Right 1093853233 12:24066907-24066929 GAGAGAACTAACTCTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093853233 Original CRISPR GAGAGAACTAACTCTACCAG TGG Intergenic
No off target data available for this crispr