ID: 1093854828

View in Genome Browser
Species Human (GRCh38)
Location 12:24088870-24088892
Sequence ATTCAGAAGGCCAGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093854828_1093854834 7 Left 1093854828 12:24088870-24088892 CCTTCTTCACTGGCCTTCTGAAT No data
Right 1093854834 12:24088900-24088922 CATGGAAAGGTTATATCACATGG No data
1093854828_1093854831 -6 Left 1093854828 12:24088870-24088892 CCTTCTTCACTGGCCTTCTGAAT No data
Right 1093854831 12:24088887-24088909 CTGAATCACATCCCATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093854828 Original CRISPR ATTCAGAAGGCCAGTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr