ID: 1093858620

View in Genome Browser
Species Human (GRCh38)
Location 12:24136087-24136109
Sequence TAGGATCCTGAAAATGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093858616_1093858620 4 Left 1093858616 12:24136060-24136082 CCAAAGAGATGGGTTAAGGGTTT No data
Right 1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG No data
1093858615_1093858620 5 Left 1093858615 12:24136059-24136081 CCCAAAGAGATGGGTTAAGGGTT No data
Right 1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093858620 Original CRISPR TAGGATCCTGAAAATGGGAA TGG Intergenic
No off target data available for this crispr