ID: 1093870396

View in Genome Browser
Species Human (GRCh38)
Location 12:24284299-24284321
Sequence TCCAGGGATCAGCCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093870396_1093870401 3 Left 1093870396 12:24284299-24284321 CCTGGTGTAGGCTGATCCCTGGA No data
Right 1093870401 12:24284325-24284347 CAAGTTTCTCAGGCTTCTCTAGG No data
1093870396_1093870402 17 Left 1093870396 12:24284299-24284321 CCTGGTGTAGGCTGATCCCTGGA No data
Right 1093870402 12:24284339-24284361 TTCTCTAGGAGTCACCTTCCAGG No data
1093870396_1093870399 -7 Left 1093870396 12:24284299-24284321 CCTGGTGTAGGCTGATCCCTGGA No data
Right 1093870399 12:24284315-24284337 CCCTGGAGGTCAAGTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093870396 Original CRISPR TCCAGGGATCAGCCTACACC AGG (reversed) Intergenic
No off target data available for this crispr