ID: 1093879473

View in Genome Browser
Species Human (GRCh38)
Location 12:24387515-24387537
Sequence GACTCAGATGTGCATTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093879467_1093879473 23 Left 1093879467 12:24387469-24387491 CCCTGCTGTAGATCCTGTCTCTG No data
Right 1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG No data
1093879470_1093879473 10 Left 1093879470 12:24387482-24387504 CCTGTCTCTGCAAAAGGAGTGAT No data
Right 1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG No data
1093879468_1093879473 22 Left 1093879468 12:24387470-24387492 CCTGCTGTAGATCCTGTCTCTGC No data
Right 1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG No data
1093879466_1093879473 24 Left 1093879466 12:24387468-24387490 CCCCTGCTGTAGATCCTGTCTCT No data
Right 1093879473 12:24387515-24387537 GACTCAGATGTGCATTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093879473 Original CRISPR GACTCAGATGTGCATTCCCT GGG Intergenic
No off target data available for this crispr