ID: 1093887292

View in Genome Browser
Species Human (GRCh38)
Location 12:24476702-24476724
Sequence CAAGGAACTCCCACTCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093887292_1093887296 11 Left 1093887292 12:24476702-24476724 CCCATTAGAGTGGGAGTTCCTTG No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093887292 Original CRISPR CAAGGAACTCCCACTCTAAT GGG (reversed) Intergenic
No off target data available for this crispr