ID: 1093887295

View in Genome Browser
Species Human (GRCh38)
Location 12:24476720-24476742
Sequence AAACACTGTTCCTTCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093887295_1093887296 -7 Left 1093887295 12:24476720-24476742 CCTTGAGAGAAGGAACAGTGTTT No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data
1093887295_1093887300 22 Left 1093887295 12:24476720-24476742 CCTTGAGAGAAGGAACAGTGTTT No data
Right 1093887300 12:24476765-24476787 AACACAGCAGAAGCACACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093887295 Original CRISPR AAACACTGTTCCTTCTCTCA AGG (reversed) Intergenic
No off target data available for this crispr