ID: 1093887296

View in Genome Browser
Species Human (GRCh38)
Location 12:24476736-24476758
Sequence AGTGTTTATTCACCTCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093887292_1093887296 11 Left 1093887292 12:24476702-24476724 CCCATTAGAGTGGGAGTTCCTTG No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data
1093887291_1093887296 12 Left 1093887291 12:24476701-24476723 CCCCATTAGAGTGGGAGTTCCTT No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data
1093887295_1093887296 -7 Left 1093887295 12:24476720-24476742 CCTTGAGAGAAGGAACAGTGTTT No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data
1093887293_1093887296 10 Left 1093887293 12:24476703-24476725 CCATTAGAGTGGGAGTTCCTTGA No data
Right 1093887296 12:24476736-24476758 AGTGTTTATTCACCTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093887296 Original CRISPR AGTGTTTATTCACCTCTGTT TGG Intergenic
No off target data available for this crispr