ID: 1093887943

View in Genome Browser
Species Human (GRCh38)
Location 12:24485032-24485054
Sequence AGGTTCGGACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093887938_1093887943 8 Left 1093887938 12:24485001-24485023 CCAGGAGTTGGAATTTAAGGGAG No data
Right 1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093887943 Original CRISPR AGGTTCGGACAGATGGAGAA AGG Intergenic
No off target data available for this crispr