ID: 1093888981

View in Genome Browser
Species Human (GRCh38)
Location 12:24496857-24496879
Sequence TTGTATATTCATAAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093888981_1093888985 29 Left 1093888981 12:24496857-24496879 CCTTGCTCTTTATGAATATACAA No data
Right 1093888985 12:24496909-24496931 GCTCATCTCCCCACTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093888981 Original CRISPR TTGTATATTCATAAAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr