ID: 1093891224

View in Genome Browser
Species Human (GRCh38)
Location 12:24524247-24524269
Sequence AGCTGAAGACCCTGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093891224_1093891226 -4 Left 1093891224 12:24524247-24524269 CCAGCACCTCAGGGTCTTCAGCT No data
Right 1093891226 12:24524266-24524288 AGCTCAGAGATAGCCTGTCATGG No data
1093891224_1093891227 -3 Left 1093891224 12:24524247-24524269 CCAGCACCTCAGGGTCTTCAGCT No data
Right 1093891227 12:24524267-24524289 GCTCAGAGATAGCCTGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093891224 Original CRISPR AGCTGAAGACCCTGAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr