ID: 1093891867

View in Genome Browser
Species Human (GRCh38)
Location 12:24531360-24531382
Sequence CAAATTATGAAAAATGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093891867_1093891872 7 Left 1093891867 12:24531360-24531382 CCCTGTGCATTTTTCATAATTTG No data
Right 1093891872 12:24531390-24531412 CAGGCACACCAATCTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093891867 Original CRISPR CAAATTATGAAAAATGCACA GGG (reversed) Intergenic
No off target data available for this crispr