ID: 1093892096

View in Genome Browser
Species Human (GRCh38)
Location 12:24534578-24534600
Sequence CTTTCTCTTTTCAAGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093892096_1093892101 30 Left 1093892096 12:24534578-24534600 CCTGAGTCCTTGAAAAGAGAAAG No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093892096 Original CRISPR CTTTCTCTTTTCAAGGACTC AGG (reversed) Intergenic
No off target data available for this crispr