ID: 1093892099

View in Genome Browser
Species Human (GRCh38)
Location 12:24534617-24534639
Sequence ATCTTGGGGTACACTCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093892099_1093892103 -8 Left 1093892099 12:24534617-24534639 CCTACATGAGTGTACCCCAAGAT No data
Right 1093892103 12:24534632-24534654 CCCAAGATGAACACCTACATGGG No data
1093892099_1093892101 -9 Left 1093892099 12:24534617-24534639 CCTACATGAGTGTACCCCAAGAT No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093892099 Original CRISPR ATCTTGGGGTACACTCATGT AGG (reversed) Intergenic
No off target data available for this crispr