ID: 1093892101

View in Genome Browser
Species Human (GRCh38)
Location 12:24534631-24534653
Sequence CCCCAAGATGAACACCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093892096_1093892101 30 Left 1093892096 12:24534578-24534600 CCTGAGTCCTTGAAAAGAGAAAG No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data
1093892099_1093892101 -9 Left 1093892099 12:24534617-24534639 CCTACATGAGTGTACCCCAAGAT No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data
1093892098_1093892101 -8 Left 1093892098 12:24534616-24534638 CCCTACATGAGTGTACCCCAAGA No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data
1093892097_1093892101 23 Left 1093892097 12:24534585-24534607 CCTTGAAAAGAGAAAGCATAACA No data
Right 1093892101 12:24534631-24534653 CCCCAAGATGAACACCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093892101 Original CRISPR CCCCAAGATGAACACCTACA TGG Intergenic
No off target data available for this crispr