ID: 1093894357

View in Genome Browser
Species Human (GRCh38)
Location 12:24561003-24561025
Sequence CAAATCCCACAGATTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093894350_1093894357 6 Left 1093894350 12:24560974-24560996 CCCTTTGCAGATTCCCACACTTA No data
Right 1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG No data
1093894349_1093894357 11 Left 1093894349 12:24560969-24560991 CCAGTCCCTTTGCAGATTCCCAC No data
Right 1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG No data
1093894353_1093894357 -8 Left 1093894353 12:24560988-24561010 CCACACTTACTGCCCCAAATCCC No data
Right 1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG No data
1093894351_1093894357 5 Left 1093894351 12:24560975-24560997 CCTTTGCAGATTCCCACACTTAC No data
Right 1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG No data
1093894352_1093894357 -7 Left 1093894352 12:24560987-24561009 CCCACACTTACTGCCCCAAATCC No data
Right 1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093894357 Original CRISPR CAAATCCCACAGATTTCCCT TGG Intergenic
No off target data available for this crispr