ID: 1093894383

View in Genome Browser
Species Human (GRCh38)
Location 12:24561119-24561141
Sequence GGTATGTGAGGATCTCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093894374_1093894383 14 Left 1093894374 12:24561082-24561104 CCTTATGCCTTCCTTGACAAAGT No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894371_1093894383 28 Left 1093894371 12:24561068-24561090 CCCTGGGGACACCTCCTTATGCC No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894372_1093894383 27 Left 1093894372 12:24561069-24561091 CCTGGGGACACCTCCTTATGCCT No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894375_1093894383 7 Left 1093894375 12:24561089-24561111 CCTTCCTTGACAAAGTCCTTTGG No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894380_1093894383 -9 Left 1093894380 12:24561105-24561127 CCTTTGGCTATCTGGGTATGTGA No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894373_1093894383 17 Left 1093894373 12:24561079-24561101 CCTCCTTATGCCTTCCTTGACAA No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data
1093894377_1093894383 3 Left 1093894377 12:24561093-24561115 CCTTGACAAAGTCCTTTGGCTAT No data
Right 1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093894383 Original CRISPR GGTATGTGAGGATCTCAAGT GGG Intergenic
No off target data available for this crispr