ID: 1093903640

View in Genome Browser
Species Human (GRCh38)
Location 12:24663895-24663917
Sequence ACATATATTTTAGAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093903640_1093903645 -1 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903645 12:24663917-24663939 TCTGACTCAGATGGGGACAGAGG No data
1093903640_1093903642 -10 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903642 12:24663908-24663930 AAATATATGTCTGACTCAGATGG No data
1093903640_1093903646 14 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903646 12:24663932-24663954 GACAGAGGATGTGCAGTATAAGG No data
1093903640_1093903648 24 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903648 12:24663942-24663964 GTGCAGTATAAGGCTACACAGGG No data
1093903640_1093903644 -8 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903644 12:24663910-24663932 ATATATGTCTGACTCAGATGGGG No data
1093903640_1093903643 -9 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903643 12:24663909-24663931 AATATATGTCTGACTCAGATGGG No data
1093903640_1093903647 23 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903647 12:24663941-24663963 TGTGCAGTATAAGGCTACACAGG No data
1093903640_1093903649 25 Left 1093903640 12:24663895-24663917 CCTTCCAACTCTAAAATATATGT No data
Right 1093903649 12:24663943-24663965 TGCAGTATAAGGCTACACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093903640 Original CRISPR ACATATATTTTAGAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr