ID: 1093903802

View in Genome Browser
Species Human (GRCh38)
Location 12:24665564-24665586
Sequence CTGGGGAAACAGAAGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093903797_1093903802 12 Left 1093903797 12:24665529-24665551 CCTGTGAAGCAGGAACTATTAAT No data
Right 1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093903802 Original CRISPR CTGGGGAAACAGAAGCAGAA AGG Intergenic
No off target data available for this crispr