ID: 1093907432

View in Genome Browser
Species Human (GRCh38)
Location 12:24709685-24709707
Sequence GATTAGTGCCGGTACTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093907432_1093907436 23 Left 1093907432 12:24709685-24709707 CCTTGTAAGTACCGGCACTAATC No data
Right 1093907436 12:24709731-24709753 ATTCTCTCATTTGCTAACTATGG No data
1093907432_1093907437 28 Left 1093907432 12:24709685-24709707 CCTTGTAAGTACCGGCACTAATC No data
Right 1093907437 12:24709736-24709758 CTCATTTGCTAACTATGGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093907432 Original CRISPR GATTAGTGCCGGTACTTACA AGG (reversed) Intergenic
No off target data available for this crispr