ID: 1093909395

View in Genome Browser
Species Human (GRCh38)
Location 12:24728591-24728613
Sequence CTGTAGAGAGATATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093909395_1093909400 11 Left 1093909395 12:24728591-24728613 CCATCCTCAATATCTCTCTACAG No data
Right 1093909400 12:24728625-24728647 AATTACAGATTAAGAAACTGGGG No data
1093909395_1093909398 9 Left 1093909395 12:24728591-24728613 CCATCCTCAATATCTCTCTACAG No data
Right 1093909398 12:24728623-24728645 CCAATTACAGATTAAGAAACTGG No data
1093909395_1093909399 10 Left 1093909395 12:24728591-24728613 CCATCCTCAATATCTCTCTACAG No data
Right 1093909399 12:24728624-24728646 CAATTACAGATTAAGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093909395 Original CRISPR CTGTAGAGAGATATTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr