ID: 1093910994

View in Genome Browser
Species Human (GRCh38)
Location 12:24747445-24747467
Sequence CATTTTTATGACATCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093910989_1093910994 -9 Left 1093910989 12:24747431-24747453 CCCTCAGTTACCCACATTTTTAT No data
Right 1093910994 12:24747445-24747467 CATTTTTATGACATCTTTGGAGG No data
1093910990_1093910994 -10 Left 1093910990 12:24747432-24747454 CCTCAGTTACCCACATTTTTATG No data
Right 1093910994 12:24747445-24747467 CATTTTTATGACATCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093910994 Original CRISPR CATTTTTATGACATCTTTGG AGG Intergenic
No off target data available for this crispr