ID: 1093919107

View in Genome Browser
Species Human (GRCh38)
Location 12:24839418-24839440
Sequence GTGAACTCAACCACAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093919103_1093919107 15 Left 1093919103 12:24839380-24839402 CCGAGATTCACTGCTGTGGTTGT 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1093919107 12:24839418-24839440 GTGAACTCAACCACAAGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 108
1093919101_1093919107 26 Left 1093919101 12:24839369-24839391 CCTGAGCAATACCGAGATTCACT 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1093919107 12:24839418-24839440 GTGAACTCAACCACAAGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093919107 Original CRISPR GTGAACTCAACCACAAGGCC TGG Intronic
901567282 1:10128523-10128545 GTGAATTAAATCACAAGGTCTGG - Intronic
904897156 1:33825647-33825669 GTGACCTCAAGCAAGAGGCCCGG + Intronic
906278702 1:44537890-44537912 GTAAACTCAACCAGAATTCCTGG + Intronic
909059890 1:70867771-70867793 GTAAATACATCCACAAGGCCAGG + Intronic
910401007 1:86838177-86838199 TTGAACTCAGCCACACAGCCAGG + Intergenic
914896861 1:151683207-151683229 GTGAACTCTGCCACATGTCCAGG - Intronic
915430694 1:155864267-155864289 GTAAGCTCTACCACAATGCCTGG + Intronic
917836816 1:178947610-178947632 GTGAAGTCAACCACAATGGGAGG - Intergenic
921261246 1:213386803-213386825 GTGAACTGAAGGACCAGGCCAGG - Intergenic
1065787175 10:29227428-29227450 GAGAACTCACCCACAAGGGAGGG + Intergenic
1069858730 10:71456916-71456938 GTGCACTTAACCACAAGTCTGGG + Intronic
1071264528 10:83953192-83953214 GTGACCACAACCACAAGGAGGGG + Intergenic
1074652419 10:115539373-115539395 GTGAACTCAACCATGAAACCTGG + Intronic
1081900646 11:46625024-46625046 ATCAACTCATTCACAAGGCCAGG + Intronic
1082777872 11:57261574-57261596 GGGAACTAAACCACCAGGGCAGG - Intergenic
1084021798 11:66422188-66422210 GTGAACACAAGCAGAAAGCCGGG - Exonic
1084478334 11:69401400-69401422 CTGATCCCAACCACAGGGCCTGG - Intergenic
1086864906 11:91969262-91969284 TTAAGCTCAACCAGAAGGCCTGG + Intergenic
1088593277 11:111421342-111421364 ATGAACTCAGACACAAAGCCAGG - Intronic
1090060123 11:123457384-123457406 GTGAACTAAACCACGAGGGTAGG - Intergenic
1090279387 11:125443029-125443051 GAAAACTCCACCACAGGGCCGGG - Intergenic
1092333189 12:7604178-7604200 TTGAACTAAAGCACAAGTCCTGG - Intergenic
1093919107 12:24839418-24839440 GTGAACTCAACCACAAGGCCTGG + Intronic
1094494709 12:30982160-30982182 GTGGACAAAACCACAAGGCAGGG - Intronic
1095223755 12:39653625-39653647 GTGATCTTAGCCAAAAGGCCAGG + Intronic
1101599617 12:106197727-106197749 TTGATCTCAGCCAGAAGGCCAGG + Intergenic
1102232465 12:111273047-111273069 GGGAACTCAAGCTCAAGTCCAGG + Intronic
1109797957 13:67341424-67341446 TTGAACTAAAGCACAAGTCCTGG + Intergenic
1113358082 13:109602210-109602232 GTGAACTCTCCCACCATGCCAGG + Intergenic
1116003760 14:39270687-39270709 ATCAAAACAACCACAAGGCCTGG - Intronic
1118600185 14:67466558-67466580 GTGAACCCACCCTAAAGGCCAGG - Intronic
1119652584 14:76394138-76394160 CTGATCTCATCCACATGGCCAGG - Intronic
1120884598 14:89441858-89441880 GAGATCCCAACCTCAAGGCCAGG - Intronic
1121119882 14:91369971-91369993 GTGAATGCAGCCACAAGGACAGG - Intronic
1124163406 15:27295461-27295483 GTGAAGGTAACCACAAGGGCTGG + Intronic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1129189772 15:73930501-73930523 CTGATCTCAAGCACAAGGCTTGG - Intronic
1130684584 15:86025667-86025689 AGGAACTCAAACACAAGGCCAGG + Intergenic
1131367967 15:91855220-91855242 ATGAACTTTACCCCAAGGCCAGG - Intronic
1132479769 16:161127-161149 ATGCACCCAACCCCAAGGCCTGG + Intronic
1134389327 16:13804833-13804855 GTGAAAGAAACCAGAAGGCCGGG + Intergenic
1141000170 16:80300418-80300440 GAGTATCCAACCACAAGGCCAGG + Intergenic
1142563576 17:825516-825538 GTGCACTCACCGCCAAGGCCAGG + Intronic
1144965118 17:19072244-19072266 GTGAAAACAGCCACAAGGCCAGG - Intergenic
1144982849 17:19179936-19179958 GTGAAAACAGCCACAAGGCCAGG + Intergenic
1144985374 17:19198303-19198325 GTGAAAACAGCCACAAGGCCAGG - Intergenic
1145201816 17:20952307-20952329 GGGAGATCAACCAAAAGGCCTGG + Intergenic
1152219497 17:79054777-79054799 GTGAACTCTATCACAAGAACAGG - Intergenic
1160411684 18:78679303-78679325 GTCATCTCAAACACAAGGCCAGG - Intergenic
1165179966 19:33959129-33959151 CTGAAATCAACCAAAAGGCCTGG + Intergenic
1168468948 19:56625517-56625539 ATGACCTCTACCTCAAGGCCAGG - Exonic
926314922 2:11702440-11702462 GTGCACTCACAGACAAGGCCTGG + Intronic
930810031 2:55530556-55530578 GTGAACTTAAGCACAGGGTCAGG - Intronic
933354857 2:81197704-81197726 GTGCACTCAAAGACAAGTCCAGG - Intergenic
935944593 2:108274046-108274068 TTGAACTTAATCACAAGGCATGG + Intergenic
941810766 2:169754145-169754167 GAGAACTCACCCACAAGGGAGGG - Intronic
942756648 2:179349066-179349088 TTGAAGTCATGCACAAGGCCAGG - Intergenic
943120817 2:183733456-183733478 CAAAACTCAACCATAAGGCCGGG + Intergenic
943645122 2:190401559-190401581 CAGAAATCAAACACAAGGCCAGG + Intergenic
945025227 2:205614373-205614395 ATCAACTCTACCACAAAGCCAGG - Intronic
948025108 2:234770492-234770514 GTGGATACAAACACAAGGCCTGG - Intergenic
1168914698 20:1476318-1476340 GCGAACACAACCAGGAGGCCTGG + Exonic
1169285150 20:4301589-4301611 GTGAGATCAACCAAAGGGCCAGG - Intergenic
1169532766 20:6503322-6503344 GTGAAATCAGTCACTAGGCCAGG - Intergenic
1170857632 20:20071636-20071658 CAGAATTCCACCACAAGGCCAGG - Intronic
1174646974 20:52094871-52094893 GTGATCTCAACCAAAATCCCAGG + Intronic
1181435791 22:22910078-22910100 GTGACCACAACCACAACTCCAGG - Intergenic
952806625 3:37361230-37361252 GTGAAGTAAACTACAAAGCCAGG - Intronic
953459639 3:43072354-43072376 GTTTACTCACCCACAAGCCCAGG - Intergenic
954126840 3:48536295-48536317 GCGAGCTCAACCTCAAGGGCCGG - Exonic
956013675 3:64858599-64858621 GCAAACTCTGCCACAAGGCCAGG + Intergenic
959736394 3:109664465-109664487 ATGAAGTCAACCCCAAGTCCAGG - Intergenic
960483896 3:118227487-118227509 GCAAACTCAACCACTGGGCCAGG + Intergenic
967952897 3:194854356-194854378 GAGAAATCAACCAGCAGGCCTGG - Intergenic
968138368 3:196235800-196235822 GTGCACACCACCACAATGCCTGG - Exonic
970822449 4:20233682-20233704 GTGCACTCCACCACCATGCCCGG + Intergenic
971518120 4:27514011-27514033 GTGAAATGAACAACAAGGCATGG - Intergenic
972183451 4:36498315-36498337 CTGAATCCATCCACAAGGCCTGG + Intergenic
972603923 4:40596708-40596730 GTGTACTCATACACAAGGCGTGG - Intronic
976324149 4:83751684-83751706 TTGATCTTAATCACAAGGCCTGG - Intergenic
981391589 4:144197204-144197226 GTGAAAGCAGCCACAAGGCAGGG + Intergenic
987766334 5:22236435-22236457 AAGAACTAAAACACAAGGCCAGG + Intronic
988882330 5:35516915-35516937 GTTGACTCAACCACTAGGCTGGG - Intergenic
1001463715 5:171942898-171942920 GTGAACTCTACCAGATGCCCTGG + Intronic
1002388895 5:178893788-178893810 GGGCACACAACCAAAAGGCCTGG - Intergenic
1004171614 6:13299781-13299803 GTGAACTGACTCACATGGCCAGG - Intronic
1004560605 6:16746121-16746143 GTGACCTGGACCACAAAGCCAGG + Intronic
1006093828 6:31643880-31643902 GAAAACTCACCCACAAGGACTGG + Exonic
1006838426 6:37013374-37013396 TTGGCCTCATCCACAAGGCCCGG - Intronic
1006844238 6:37051470-37051492 GGGCTCTCAGCCACAAGGCCTGG - Intergenic
1009958627 6:70489885-70489907 AGGAGCCCAACCACAAGGCCAGG + Intronic
1018404053 6:163458195-163458217 TTGATCTTAACCAAAAGGCCAGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1022495744 7:30852041-30852063 TTGAACTCACCCACTAGGCTGGG - Intronic
1027992871 7:85385513-85385535 TTAAACTCAGCCACAAGGACAGG - Intergenic
1030541033 7:110831018-110831040 GTGAACTCTCCCCCAGGGCCAGG - Intronic
1033090470 7:138380884-138380906 GTGATCTCTACCACAAAGACTGG - Intergenic
1033507285 7:142017671-142017693 GTGAACTCAACCTCAATCCACGG - Intronic
1039882756 8:41635865-41635887 AAGAACTCAAACAGAAGGCCGGG + Intergenic
1040556232 8:48479492-48479514 CTGAACACAACAACAAGGCAGGG - Intergenic
1042818548 8:72904994-72905016 GTGAACTCTTCCACAAGATCTGG + Intronic
1044852236 8:96440438-96440460 GTGAAATAAAACACAGGGCCAGG + Intergenic
1047415286 8:124659958-124659980 GGGAACTGAATCACAAGGTCTGG - Intronic
1052423903 9:28278555-28278577 GTGAACAAAACAACAAAGCCTGG + Intronic
1053804648 9:41788984-41789006 GAGATCTCAACCAAAAGGTCTGG + Intergenic
1054879567 9:70130692-70130714 ATGAACTCTACATCAAGGCCTGG - Intronic
1059618705 9:115979548-115979570 CTGAAGCCAACAACAAGGCCAGG + Intergenic
1061037184 9:128120393-128120415 CTGAACTCTCCCACAAGGCGGGG + Intergenic
1061365066 9:130168417-130168439 GGGGACTCAAGGACAAGGCCGGG - Intergenic
1061432819 9:130542204-130542226 TTGAAGTAAACCACAATGCCAGG + Intergenic
1062658568 9:137616483-137616505 GACAACTCTGCCACAAGGCCAGG - Intronic
1185739454 X:2519228-2519250 GAGAACTCTATCACGAGGCCGGG - Intergenic
1186872180 X:13783949-13783971 GTGACATTAACCACTAGGCCTGG - Intronic
1192415516 X:70976798-70976820 GGGTACTCAACCACCATGCCAGG + Intergenic
1192673016 X:73166591-73166613 TTGAACTTAACCACAGGGCATGG + Intergenic
1200100055 X:153685819-153685841 GTGAACTCCTCCTCACGGCCTGG - Intronic