ID: 1093920030

View in Genome Browser
Species Human (GRCh38)
Location 12:24849282-24849304
Sequence TGGCCACACCTGCTGCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093920030_1093920033 15 Left 1093920030 12:24849282-24849304 CCAGTTGGCAGCAGGTGTGGCCA 0: 1
1: 0
2: 3
3: 27
4: 201
Right 1093920033 12:24849320-24849342 AAGACAGCACTTCAGTGAAGCGG 0: 1
1: 0
2: 3
3: 24
4: 252
1093920030_1093920034 16 Left 1093920030 12:24849282-24849304 CCAGTTGGCAGCAGGTGTGGCCA 0: 1
1: 0
2: 3
3: 27
4: 201
Right 1093920034 12:24849321-24849343 AGACAGCACTTCAGTGAAGCGGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093920030 Original CRISPR TGGCCACACCTGCTGCCAAC TGG (reversed) Intronic
900647510 1:3715592-3715614 TGGCCACATCCACTGCCCACTGG - Intronic
900799215 1:4727210-4727232 TGGCCTCTCCTGCTGCCCGCTGG - Intronic
900870820 1:5301474-5301496 TGGACACACCTGCAGCAAGCAGG + Intergenic
900914024 1:5621796-5621818 GGGCCACACTTGCTGCCAGGCGG + Intergenic
905294389 1:36945023-36945045 TGGGCACACCTGCTGCCCACAGG - Intronic
905622341 1:39459173-39459195 CAGCCACACCTGCTGCCAGCGGG - Exonic
905826276 1:41028148-41028170 TGCCCCCACCTGCTGCCACTTGG + Exonic
907440970 1:54477989-54478011 TGGCCACACCTCCTGTGAAATGG - Intergenic
909532272 1:76694321-76694343 TGGCCACACCTGGGGCCTATAGG + Intergenic
909759773 1:79272186-79272208 TGTACACACCTGTTGCCAGCAGG - Intergenic
910613532 1:89170856-89170878 TGGCCTTACTTGCTGCCATCAGG + Intronic
911505952 1:98751548-98751570 TGGCTACAACTGCAGCCACCTGG + Intronic
913227576 1:116713556-116713578 GAGCCACAGCTGCTGACAACAGG + Intergenic
913281775 1:117191705-117191727 TCACCACACCTTCTGCCACCTGG - Intronic
913285797 1:117225255-117225277 TGACCAATCCTGCTGTCAACAGG - Intergenic
917041259 1:170808652-170808674 AAGCCACTCCTGCTGCAAACTGG - Intergenic
917730449 1:177870161-177870183 TGGCTGTACCTCCTGCCAACTGG - Intergenic
921218737 1:212958349-212958371 TGGCCACACTTCCTGCCCAACGG - Intronic
921259083 1:213369724-213369746 TGGCCACACCAGCTGCCTAGGGG - Intergenic
922696579 1:227733898-227733920 TGGCCTCACCAGCTGCCCGCAGG + Exonic
923282459 1:232457262-232457284 AGGCCACTCATGCTGCCCACAGG + Intronic
924539081 1:244964228-244964250 TGCCCACAAATGCTGCCACCCGG + Intergenic
1067166368 10:43869235-43869257 TGTCCACACCTGCCCCCACCCGG + Intergenic
1067451522 10:46384859-46384881 TGGCCCCACCCCCTGCCATCTGG + Intronic
1067585717 10:47474897-47474919 TGGCCCCACCCCCTGCCATCTGG - Intronic
1070311305 10:75275936-75275958 TGGCCACACCTGTTGCTGCCAGG + Intergenic
1070724001 10:78775622-78775644 TGGCCACATGAGCTTCCAACTGG - Intergenic
1070832091 10:79424380-79424402 TGGGCAAATCAGCTGCCAACTGG - Intronic
1073205459 10:101767094-101767116 TGGCCTCACCTGCTTCCATTTGG + Intergenic
1074435870 10:113433727-113433749 TGGCCAAATCTGATGTCAACAGG - Intergenic
1074756004 10:116624584-116624606 TGGGCAGACCTGCTGAAAACTGG - Intronic
1075414038 10:122249427-122249449 TGGCCCCAGCTGCCACCAACTGG - Intronic
1076064560 10:127439279-127439301 TTGCCCCACCTGTAGCCAACAGG + Intronic
1076995098 11:293933-293955 TGGCCACACCTGCCTCCCACTGG + Intronic
1077189993 11:1251958-1251980 TGGCCACACTTGGTCCCCACTGG + Intronic
1077190053 11:1252178-1252200 TGGCCACACTTGGTCCCCACTGG + Intronic
1077532067 11:3102011-3102033 TGGACCCAGCCGCTGCCAACAGG - Intronic
1079283650 11:19109608-19109630 GGGCCACACCTGACCCCAACAGG - Intergenic
1080957413 11:37115541-37115563 TGTTCAAACCTGCTGACAACTGG - Intergenic
1082832596 11:57630047-57630069 TGGCCATAACTGCTGCCGAATGG - Intergenic
1083302317 11:61745524-61745546 TGGCCCCACCTCCTACCAACAGG - Exonic
1083741235 11:64712704-64712726 TGACCACACAGGCTGCCCACAGG + Intronic
1085219925 11:74865166-74865188 TGGCCCCTCCTGCTGCAATCAGG + Intronic
1085451673 11:76637725-76637747 TGGCAACAGCTGCAGCCAGCTGG - Intergenic
1088994621 11:114985715-114985737 TGTCCACACCTGCTGGGGACAGG + Intergenic
1091237963 11:134034270-134034292 TGGCCAGCCCTGCTGGAAACCGG + Intergenic
1091367141 11:135031738-135031760 TGGCCTCACCTCCTGCCTGCTGG - Intergenic
1093111260 12:15155229-15155251 TGCACACACCTGGTGCCACCTGG + Intronic
1093920030 12:24849282-24849304 TGGCCACACCTGCTGCCAACTGG - Intronic
1093944887 12:25096990-25097012 TGGCCACTCGTGCTGCACACTGG - Exonic
1094492324 12:30968794-30968816 TTGCCACACCTCCATCCAACAGG + Intronic
1096913714 12:55009873-55009895 TGGCCACAGCTGGTACCCACAGG + Intergenic
1098359744 12:69642764-69642786 CTGCCAGACCTGCTGCCAATGGG + Intergenic
1099143263 12:79007095-79007117 GGGCCACTCCTGCTGCTGACAGG + Intronic
1100676420 12:96873546-96873568 TGGCCACTGTTGCTGCCAACAGG - Intronic
1101550531 12:105757263-105757285 TGGCCACAGCGGCAGGCAACAGG - Intergenic
1101796950 12:107983729-107983751 TGTCCACTCCTGCTGGAAACAGG + Intergenic
1102119492 12:110429452-110429474 TGGCCACACCTGCTGCTGCCAGG + Intergenic
1102638451 12:114345156-114345178 TGGCCAAAGCTGCTGTCCACAGG - Intergenic
1105723008 13:23135022-23135044 TGGCCACACCTGCTGCTGCCAGG - Intergenic
1105881510 13:24610179-24610201 TGGGAACACTTACTGCCAACAGG - Intergenic
1106414447 13:29534673-29534695 TGGCCACACATGCTGCCTGCTGG - Intronic
1107502336 13:40993355-40993377 TGCCCACACCTGCAGGCAACTGG - Intronic
1108272380 13:48774302-48774324 TGGCCACACCTGCATTCAATAGG + Intergenic
1113553967 13:111216396-111216418 TGGAATCACCTGCTGCCACCTGG + Intronic
1115695831 14:35897897-35897919 TAGCCACTGCTGCTGCCACCAGG - Intronic
1118647217 14:67851586-67851608 TGGCCACCCCTGCTGCCCCCAGG - Intronic
1121708746 14:96021026-96021048 TGTCCACTTCTGCTGCCCACTGG + Intergenic
1122535380 14:102458341-102458363 TGGGCACACCTGGTGCCAGGAGG - Intronic
1124358708 15:29018583-29018605 TGGCCACACCTGCCACCAGGTGG - Intronic
1125475994 15:40048422-40048444 TGACCACCCCTGGTGCAAACAGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1128329430 15:66745976-66745998 TGGCCACACCTGCCTGCAACAGG - Intronic
1129030352 15:72612936-72612958 TTGCCACCACTGCTGCCACCTGG + Intergenic
1129193500 15:73951288-73951310 TGGCTCCCCCTGCTGCCCACAGG - Intronic
1129226119 15:74171396-74171418 TGGCCATACCCGCTTCCACCAGG - Intergenic
1130371521 15:83288690-83288712 TGCCCAGACCTGCCGCCACCAGG - Intergenic
1132640822 16:977570-977592 TGCACACACCGGCTGCCAGCGGG + Intronic
1132865010 16:2088991-2089013 TGCCCAGACCTGATGCCAGCAGG + Exonic
1132884251 16:2175630-2175652 TGGGCACACCTGGTGGCCACAGG + Intronic
1132958347 16:2608567-2608589 TGGCCATACATGCTGCCTTCAGG - Intergenic
1132970959 16:2688663-2688685 TGGCCATACATGCTGCCTTCAGG - Intronic
1134254470 16:12600338-12600360 TGGGCACAACTGCAGCCACCCGG + Intergenic
1137626203 16:49910360-49910382 TGACCACACCTGCTGTGATCTGG + Intergenic
1137758414 16:50920590-50920612 TGACCCCACCTGCTGCCACACGG + Intergenic
1142199663 16:88755025-88755047 TGGACACACCTGCGGCCATCAGG + Intronic
1142403152 16:89871571-89871593 TGGCCACACCTGCTGGCCTGGGG + Intergenic
1142749556 17:1978929-1978951 GGGCCACACCTTCTGCTATCTGG - Intronic
1143109953 17:4547621-4547643 TGGGAACACCTTCTGGCAACGGG - Intronic
1144317627 17:14078319-14078341 AGGCCACATCTGATGCCTACGGG - Intronic
1147190448 17:38735313-38735335 GGGCCACCACAGCTGCCAACGGG - Exonic
1147918846 17:43904271-43904293 TGGCCACAGCAGCTGCCAGAAGG + Intronic
1147993574 17:44349684-44349706 TGGCCATCACTGCTGCCCACGGG + Exonic
1148769373 17:50057936-50057958 TGGCCCCAGCAGCTGCCACCTGG + Intronic
1151124654 17:71831845-71831867 TGTCCACTCCTGCTGAGAACTGG + Intergenic
1152179193 17:78807265-78807287 TGGCTACAGCCACTGCCAACGGG - Exonic
1152190207 17:78883562-78883584 GGGCCACACCGCCTGCCAGCGGG + Intronic
1152511815 17:80795133-80795155 TGGCCACCGCTGCGGACAACAGG + Intronic
1152661453 17:81544200-81544222 GGGCCTCACGTGCTGCCAGCTGG - Intronic
1152757605 17:82093472-82093494 TGAGCACACCTCCTGCCACCAGG + Intronic
1153000688 18:452831-452853 TGGCCACAGGTGCTTCCAAGTGG + Intronic
1153706187 18:7748100-7748122 TGGCCACACCTACTGCAAGAGGG - Intronic
1153988815 18:10376865-10376887 TTTCCACTCCTGCTGCCAGCTGG - Intergenic
1154001702 18:10487357-10487379 TGGCCACACCTGCAGCATATCGG + Intronic
1155008835 18:21754853-21754875 TGAACCCAACTGCTGCCAACTGG - Intronic
1156850707 18:41722650-41722672 TGGCCACCATTGCTGCTAACAGG + Intergenic
1159022054 18:63151413-63151435 TGGCCACCCCTTCTGCCACCAGG - Intronic
1160397783 18:78584577-78584599 TGCCCACACCTGCTCAGAACGGG - Intergenic
1162344969 19:10113611-10113633 TGGTGACACCTTCTGCCCACAGG + Exonic
1165102999 19:33449975-33449997 TGGCCACTCCTGCACCCAAGCGG - Intronic
1168585573 19:57588804-57588826 TGGGAACACCTGCTGCCCAGTGG + Intronic
926089043 2:10038180-10038202 TGGACACACCTCCTGCCACGTGG - Intergenic
926767886 2:16338223-16338245 ATGCCACACCTGCTGCCCAGGGG + Intergenic
928264955 2:29803266-29803288 TGCCCACATCTGCTGCCTAATGG - Intronic
928925408 2:36573851-36573873 TTCCCACACCTCCCGCCAACAGG - Intronic
930031076 2:47058429-47058451 AGGCCTCTCCTGCTGCCTACTGG + Intronic
932757314 2:74417633-74417655 TGGCCACACCTGCTGCTGCCAGG + Exonic
933083404 2:78023552-78023574 TAGCCACTGCTGCTGCCACCAGG - Intergenic
933597074 2:84292759-84292781 TGGCCCCTCCTGCTGATAACTGG - Intergenic
935071775 2:99700784-99700806 TGTCCCCATCTTCTGCCAACAGG - Intronic
937160757 2:119759428-119759450 TGGGGCGACCTGCTGCCAACTGG + Intergenic
937296176 2:120811193-120811215 TGCCCACTCCTCCTGCCATCTGG - Intronic
937338116 2:121074545-121074567 TGGCCACACTTCCTGCCTCCAGG + Intergenic
937533612 2:122858848-122858870 TGGCCCCGCCTGCTGCCAAAAGG + Intergenic
938296960 2:130184489-130184511 TGATCACACCTGCTGACACCTGG - Intronic
940711422 2:157167037-157167059 TAGCCACACTGGCAGCCAACTGG - Intergenic
943085861 2:183310313-183310335 TGGCCGCACCTGCTGCCTCCCGG - Intergenic
945979237 2:216295795-216295817 TAGCCACACCTGGAGACAACTGG - Intronic
947990031 2:234479524-234479546 AGGCCACACCAGCAACCAACTGG + Intergenic
1170803190 20:19607316-19607338 TGGCCACACCTCCTTCAAAAGGG + Intronic
1173593642 20:44244878-44244900 TCCCCACACCTGCTGCCAGCTGG - Intergenic
1173656004 20:44700775-44700797 TGGCCACAGTGGCTGCCAGCAGG - Intergenic
1174097934 20:48104309-48104331 TGGTCTCATCTGGTGCCAACTGG + Intergenic
1175144433 20:56885055-56885077 TGTCCACAGCTGCTCCCAACTGG + Intergenic
1175251114 20:57610739-57610761 TGGCCCCAGCTCCTGCCATCTGG + Intronic
1175418748 20:58818004-58818026 TGGCCTCACGTGCTGCCGGCTGG + Intergenic
1175973486 20:62698891-62698913 TGGCCAGCCCTGCTGCCCCCTGG - Intergenic
1180029915 21:45200070-45200092 GGGACACAGCTGCAGCCAACTGG - Intronic
1180758264 22:18178327-18178349 CGGCAACACTTGCTGGCAACCGG - Intergenic
1180768552 22:18362119-18362141 CGGCAACACTTGCTGGCAACCGG - Intergenic
1180777758 22:18500272-18500294 CGGCAACACTTGCTGGCAACCGG + Intergenic
1180810484 22:18757583-18757605 CGGCAACACTTGCTGGCAACCGG + Intergenic
1180826427 22:18865343-18865365 CGGCAACACTTGCTGGCAACCGG - Intergenic
1181196628 22:21191838-21191860 CGGCAACACTTGCTGGCAACCGG + Intergenic
1181212899 22:21301286-21301308 CGGCAACACTTGCTGGCAACCGG - Intergenic
1182255020 22:29031733-29031755 TGGCCACGCCTGACGCCCACAGG - Intronic
1182921985 22:34088696-34088718 TGGCCACAGATGCAGCCCACAGG + Intergenic
1184296231 22:43527232-43527254 TGGGAACATCTGCTGCCCACAGG + Intergenic
1184783404 22:46660128-46660150 TGGGCACACCTGCCACCAAGGGG - Intronic
1185088280 22:48752461-48752483 TGCCCACACCTGAGGCCACCTGG + Intronic
1203230170 22_KI270731v1_random:103007-103029 CGGCAACACTTGCTGGCAACCGG - Intergenic
1203276570 22_KI270734v1_random:91249-91271 CGGCAACACTTGCTGGCAACCGG - Intergenic
951663396 3:25095499-25095521 TGGCCATACATCCTCCCAACAGG + Intergenic
954671385 3:52293049-52293071 GGGGCACACCTGCTGCACACAGG + Exonic
954705906 3:52480378-52480400 TGCCAGCACCTGCTTCCAACAGG + Intronic
960949925 3:122992656-122992678 TTGCCTCACCTCATGCCAACTGG - Intronic
961437134 3:126927133-126927155 TGGCCACAGCTGCTGCTTAGAGG - Intronic
961610264 3:128131860-128131882 TGCCCCCACCTGCCGCCAGCAGG + Intronic
962492496 3:135908024-135908046 TGGCTACACCTGGTGTCAGCAGG - Intergenic
963501304 3:146130762-146130784 TGGCCTCCCCTGGTGACAACAGG + Intronic
964392896 3:156215790-156215812 TGGCCTCCACTGCTGCCTACAGG + Intronic
966912126 3:184565494-184565516 TGGCCCCACCTCCTGCGATCTGG - Intronic
967133354 3:186492908-186492930 TGCCCACAGCTGCTGCCCTCGGG + Intergenic
974033649 4:56798122-56798144 TAGTAACACCTGCTGTCAACTGG + Intergenic
976926569 4:90505245-90505267 TGGCCAGACGTGCTCCCATCTGG + Intronic
980185322 4:129453991-129454013 TGGCAAAACCTCCTGCCAAGTGG - Intergenic
981119014 4:141026945-141026967 TGGCCACATCTGAAGCCAAGAGG - Intronic
981638708 4:146911236-146911258 GGGCCACACATGATGCCCACTGG - Intronic
982025678 4:151251990-151252012 CCACCACACCTGCTGCCAAGTGG + Intronic
982722024 4:158869190-158869212 TGGACACACCTGGGGGCAACAGG - Exonic
989127976 5:38075289-38075311 TGGCCACAGCTGCTGCCCACTGG - Intergenic
991772948 5:70056813-70056835 TGGCAACACCTGGTCCTAACTGG + Intronic
991852241 5:70932237-70932259 TGGCAACACCTGGTCCTAACTGG + Intronic
992208733 5:74456416-74456438 TAGCCACACCTGCTTCTAACAGG + Intergenic
993062479 5:83055331-83055353 TGTCCAGCTCTGCTGCCAACTGG - Exonic
995217724 5:109614366-109614388 TGGGCCATCCTGCTGCCAACTGG - Intergenic
1000824889 5:166032821-166032843 TGGCCACACCTGACTCCAAAGGG - Intergenic
1001434489 5:171688707-171688729 TGGCCCCACTTGCAGCCAACAGG + Intergenic
1006474427 6:34245372-34245394 TGGCCACACCTGCTGCTGCCAGG - Exonic
1006990715 6:38212606-38212628 TGGCCACACCCCTTGCCAGCAGG + Intronic
1007223240 6:40295189-40295211 TGGCCATTCCTGCAGGCAACTGG + Intergenic
1007591995 6:43027484-43027506 TGGGCACAACTGTTGCTAACAGG + Intronic
1007947410 6:45838697-45838719 TCCCCACACCTGCTGTCAACAGG + Intergenic
1008595322 6:53035982-53036004 ATGCCACATCGGCTGCCAACTGG - Intronic
1009587641 6:65627642-65627664 TGGCCAGCCCTGCTGGCACCAGG + Intronic
1012067107 6:94561568-94561590 TGTCAACTCCTGCTGCCACCAGG + Intergenic
1013184577 6:107746596-107746618 TGGCCACACCTGCTGTCTCCAGG + Intronic
1015343277 6:132126934-132126956 TCCCCACACCTACTGCCAAATGG + Intergenic
1015519275 6:134114822-134114844 TGGCCACAGGTGCTGCCTCCAGG + Intergenic
1016937247 6:149456579-149456601 TGGCCACGCCTGCTACCAGGTGG - Intronic
1018419557 6:163630314-163630336 TGGGCGCTCCTGCTGCGAACTGG + Intergenic
1019183402 6:170207188-170207210 TGGCTGCACCTGCTGCCTGCAGG + Intergenic
1020268067 7:6574687-6574709 TGGCCCCACCTACTGGCCACAGG + Intergenic
1021812765 7:24419297-24419319 TGGCCACACCTAGTGGCAAAGGG + Intergenic
1022571928 7:31462834-31462856 TGGCCACACCTGATTTCAAGAGG - Intergenic
1022847469 7:34225374-34225396 TGGTCCCAGCTGCTGCCCACAGG - Intergenic
1023905003 7:44515947-44515969 TGGCCACACCTGCAAACACCTGG + Exonic
1026464328 7:70640944-70640966 TGGCCACACTGGCTGCCATGTGG - Intronic
1029014555 7:97302083-97302105 TGGCCAAACCTGCTGTCAACGGG + Intergenic
1029918507 7:104237476-104237498 TGGCCCCACCTGCAGCCACTTGG + Intergenic
1034196638 7:149253548-149253570 TGACCCCACCTGCTGCAAAGTGG - Exonic
1034694116 7:153039009-153039031 GGGCCCCACCTGCTGCCAAGAGG + Intergenic
1036652635 8:10655012-10655034 TGGCCAGCCCTGCTGCCCAGAGG - Exonic
1036743832 8:11390192-11390214 TGGCCACACATTCTGCCAGAAGG - Intergenic
1037993981 8:23339738-23339760 CGGCGACTCCTGGTGCCAACAGG + Intronic
1040535134 8:48302564-48302586 TGGACACATCTGATGGCAACTGG - Intergenic
1046224047 8:111253340-111253362 TGACAAAACGTGCTGCCAACTGG + Intergenic
1048904315 8:139073239-139073261 GGGCCATACCTGTTGCCCACAGG - Intergenic
1048956609 8:139542817-139542839 TGGCCATACCTGCTGGCCCCTGG - Intergenic
1049341283 8:142113897-142113919 AGGGCACACCTGCTGCCACCAGG + Intergenic
1049389545 8:142360804-142360826 AGGCCACACCCACTGCCCACCGG + Intronic
1052560405 9:30077462-30077484 TAGCCACACTGGCAGCCAACTGG + Intergenic
1056789855 9:89618344-89618366 TGGGCACACCTGTTGCCAAAAGG - Intergenic
1057175356 9:92993305-92993327 TGGCCACTCCTGCTGTCTTCTGG + Intronic
1058419442 9:104820297-104820319 TGGCCAGGCCTGCTGGAAACAGG - Intronic
1059041724 9:110822356-110822378 TGGTCACACCTGAAGCCAGCAGG - Intergenic
1060887162 9:127162606-127162628 AGGCCATACCTGCTGCGGACTGG - Intronic
1061022168 9:128022983-128023005 TGGCCAGACCTGCTCCCCTCTGG - Intergenic
1061368715 9:130186078-130186100 TGGCCACACATGCCCCCCACAGG - Intronic
1061656608 9:132096557-132096579 TAGCCACACTGGCAGCCAACTGG + Intergenic
1062380170 9:136283339-136283361 TGGTTCCACCTGCTGCCATCTGG - Intronic
1185614968 X:1415240-1415262 TGGCCTCAGCAGCTGCCACCTGG + Intronic
1188156537 X:26748843-26748865 TGGCCACACCTGCTGCTGCCAGG - Intergenic
1190061749 X:47216103-47216125 TGCCCACATCTGCTGCCTCCTGG + Intergenic
1190757697 X:53415048-53415070 TGGGCAAGCCAGCTGCCAACCGG - Exonic
1194023319 X:88721212-88721234 TAGCCACACTGGCAGCCAACTGG + Intergenic
1194800300 X:98264504-98264526 TTGCCATACCTGCTGCCCAGGGG + Intergenic
1195870019 X:109475787-109475809 TGTCCACACCTGCTGCGGAAGGG + Exonic
1196648242 X:118141100-118141122 GTGGCACACCTGCTGCCAAGGGG + Intergenic
1197375957 X:125682282-125682304 TAGACACACCTTCTGCCAAAAGG + Intergenic
1198311334 X:135427357-135427379 TGGCCACAGCTGCTCCCACTGGG - Intergenic
1200141819 X:153906286-153906308 TGGCCACAGCTGCTGACACGTGG - Exonic