ID: 1093922026

View in Genome Browser
Species Human (GRCh38)
Location 12:24869435-24869457
Sequence TGGAACTTATTGGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 3, 2: 15, 3: 68, 4: 516}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093922026_1093922032 21 Left 1093922026 12:24869435-24869457 CCCTTTTTTCCCAATAAGTTCCA 0: 1
1: 3
2: 15
3: 68
4: 516
Right 1093922032 12:24869479-24869501 TCTGCGAGCCTAATTTTTCATGG 0: 2
1: 46
2: 146
3: 274
4: 374
1093922026_1093922034 28 Left 1093922026 12:24869435-24869457 CCCTTTTTTCCCAATAAGTTCCA 0: 1
1: 3
2: 15
3: 68
4: 516
Right 1093922034 12:24869486-24869508 GCCTAATTTTTCATGGCCTTGGG 0: 1
1: 0
2: 32
3: 98
4: 318
1093922026_1093922033 27 Left 1093922026 12:24869435-24869457 CCCTTTTTTCCCAATAAGTTCCA 0: 1
1: 3
2: 15
3: 68
4: 516
Right 1093922033 12:24869485-24869507 AGCCTAATTTTTCATGGCCTTGG 0: 1
1: 0
2: 34
3: 89
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093922026 Original CRISPR TGGAACTTATTGGGAAAAAA GGG (reversed) Intronic
900469370 1:2845597-2845619 GTGACCTTATTTGGAAAAAAGGG - Intergenic
900727659 1:4228367-4228389 TGGAATTTATTGGGCGAAAAAGG - Intergenic
900866581 1:5273271-5273293 CAGAACTGATTGGGAAAGAAAGG + Intergenic
902357145 1:15912432-15912454 TGGAATTTATAGGGTAAACATGG + Intronic
902921755 1:19670218-19670240 TGGAAATTAGTGGGAGAACAGGG - Intronic
903138821 1:21326504-21326526 TAGAACCTAGTGAGAAAAAAGGG + Intronic
905683796 1:39894186-39894208 TGCCACTTATTGGGATGAAATGG - Intergenic
905925519 1:41746799-41746821 TGGAAGTTCTTGGGAATTAATGG + Intronic
906761153 1:48380458-48380480 TGGAATTCATTTGGAAAAGAGGG + Intronic
906867435 1:49437756-49437778 TGGAAATTATTAGAAAAAAATGG + Intronic
907538807 1:55193001-55193023 TGAAAATATTTGGGAAAAAATGG + Intronic
908045071 1:60160092-60160114 TATAAGTTATTGGGAAAAGATGG - Intergenic
908061054 1:60349657-60349679 TGGAACATGTTAGGAAAAGATGG + Intergenic
908339019 1:63157305-63157327 ATGACCTTATTTGGAAAAAAGGG - Intergenic
909007683 1:70296719-70296741 TACAATTTATTGGGAAAGAAAGG - Intronic
909692270 1:78422122-78422144 TGGAACTTTTTGGCTACAAAGGG - Intronic
909856657 1:80542070-80542092 TGGACCTTTAGGGGAAAAAAAGG + Intergenic
910245937 1:85138038-85138060 GGGAGCTTATTGGGAAACGATGG + Intergenic
910919131 1:92324845-92324867 AGAGACTTATTGGGAAATAATGG + Intronic
911032094 1:93500125-93500147 TGGAACTTATTCAGTAAAAATGG + Intronic
911208982 1:95119814-95119836 TGGGACTAATTTGGAAAGAAGGG - Intronic
911496176 1:98634214-98634236 TGAAACTTACGGGGAAAATACGG - Intergenic
914345245 1:146793502-146793524 TGGATATTGTTGGGAACAAATGG - Intergenic
914348003 1:146816296-146816318 ATGACCTTATTTGGAAAAAAGGG - Intergenic
914907614 1:151759743-151759765 TGGAGTTTATTGGGACAAACAGG - Exonic
914927914 1:151905303-151905325 TGGAATTTATTGGGCAAAAAAGG - Intronic
915004657 1:152624514-152624536 TCACACTTAATGGGAAAAAAGGG + Intergenic
917103529 1:171469584-171469606 TGGAACTCAGTAGGGAAAAAAGG + Intergenic
917961878 1:180152110-180152132 TGGAACTTCCTGGGATGAAAAGG - Intergenic
918161836 1:181908416-181908438 TGGAAATTATTTGATAAAAAGGG + Intergenic
918165367 1:181940740-181940762 AACAGCTTATTGGGAAAAAAGGG - Intergenic
918254109 1:182732711-182732733 TGGTACTGATTGACAAAAAAGGG + Intergenic
918369456 1:183844692-183844714 TGGAACTTCTGGGGAACAGATGG + Intronic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919353943 1:196497142-196497164 TGGAACTTAATGGATACAAAGGG - Intronic
919744956 1:201003000-201003022 AGGAACAGAGTGGGAAAAAATGG - Intronic
920739143 1:208563773-208563795 TGGAAATGTTTGGGAAAACATGG - Intergenic
921273045 1:213489861-213489883 TGGAAGTTATTTGGACATAAAGG + Intergenic
921494818 1:215826447-215826469 GGGAACATATTTGGATAAAATGG + Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921752198 1:218808511-218808533 TGGAACATATTTGGAACATAAGG - Intergenic
921901764 1:220458334-220458356 TGAAATTTATTGGGTGAAAAAGG - Intergenic
922593132 1:226793877-226793899 TGGAAGATTTTTGGAAAAAAGGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
923340287 1:233000999-233001021 TGAAACTTTAGGGGAAAAAATGG - Intronic
924096897 1:240561409-240561431 TGGAAATTAATGGGACAAATTGG - Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924613188 1:245590343-245590365 TGGCACTTATTGTGAATAAAGGG - Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063740739 10:8816338-8816360 TTGCACTTGATGGGAAAAAAAGG - Intergenic
1063978370 10:11434792-11434814 TGGAATTTATTGGGAGAAAACGG + Intergenic
1064002244 10:11673328-11673350 TGGGGCATATTGGGAAGAAAGGG - Intergenic
1064334176 10:14423432-14423454 TGGAATTTATTGGGCAAAAAGGG - Intronic
1065643824 10:27814128-27814150 TGGAATTTATTGGGCAAAATGGG + Intronic
1066739957 10:38510861-38510883 TGGAATATAATGGAAAAAAATGG + Intergenic
1066764233 10:38788129-38788151 TGGAATCGATTGGAAAAAAATGG - Intergenic
1066764772 10:38792689-38792711 TGGAATTTACTGGAACAAAATGG - Intergenic
1066765668 10:38800368-38800390 TGGAACTTATTCGAATAGAATGG - Intergenic
1066770631 10:38842599-38842621 TGGAATGTATTGGAACAAAATGG + Intergenic
1066771113 10:38846642-38846664 TGGAATTTATTAGAAAAGAATGG + Intergenic
1066771892 10:38853067-38853089 TGGAATTTATTCGAAAAGAATGG + Intergenic
1066772600 10:38858804-38858826 TGGAATGTACTGGAAAAAAATGG + Intergenic
1066773020 10:38862242-38862264 TGGAATTTATTCGAAAAGAATGG + Intergenic
1066773050 10:38862550-38862572 TGGAATTGACTGGAAAAAAATGG + Intergenic
1066774691 10:38875879-38875901 TGGAATTTACTGGAACAAAATGG + Intergenic
1066777506 10:38899320-38899342 TGGAACTTATTCGAATAGAACGG + Intergenic
1066778237 10:38905484-38905506 TGGAACAGACTGGAAAAAAATGG + Intergenic
1066945451 10:41908108-41908130 TGGAACTCAATGGAAAAGAATGG + Intergenic
1067675787 10:48375281-48375303 TTGTACTGATTGGGCAAAAACGG + Intronic
1069917687 10:71797503-71797525 TGGAACAGATTGAGAAAAAATGG + Intronic
1071423186 10:85522570-85522592 TGGCAGTTACTGGGAAAAAAGGG - Intergenic
1071671840 10:87616272-87616294 TGGACCTTATTTAGAAAAAAGGG + Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1072696506 10:97607724-97607746 TTGTACTTATTGGGAAGAATTGG + Intronic
1072718470 10:97766849-97766871 AATAACTTATTGGGATAAAAGGG + Exonic
1073865188 10:107795048-107795070 TGCAAGTTATTGGGATCAAAAGG - Intergenic
1074580937 10:114718730-114718752 TGGAAGGTCTTGGGCAAAAATGG - Intergenic
1075502810 10:122992849-122992871 TGGAAATTATGGGCAGAAAATGG + Exonic
1076584038 10:131533220-131533242 TTGACTTTATTGGGAAAGAAAGG + Intergenic
1077957595 11:7037737-7037759 TGGAAGATATTAGTAAAAAATGG + Intronic
1078180307 11:9004801-9004823 TAGCACTTATTGAGAAAAACAGG - Intergenic
1079939113 11:26655910-26655932 TAGGAATTATTGGGAGAAAACGG + Intronic
1080165900 11:29236076-29236098 TTAAACTTAATGGGAATAAATGG + Intergenic
1080165936 11:29236956-29236978 TTAAACTTAATGGGAATAAATGG - Intergenic
1080187580 11:29508557-29508579 TGGTCCTTATTAGGAAGAAAGGG + Intergenic
1080394567 11:31877833-31877855 TGCAACTTATAGGTAAAACATGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080903443 11:36517093-36517115 TTGAACTTGGTGGGAAAAACAGG + Intronic
1080952576 11:37052309-37052331 TGTAATTTATAAGGAAAAAAAGG - Intergenic
1081589785 11:44413699-44413721 TGGAAAATATTTGGGAAAAAAGG + Intergenic
1082165589 11:48946512-48946534 AGGAACTTATAGGGAACAAATGG + Intergenic
1082169111 11:48980855-48980877 AGGAACTTATGGTGAACAAATGG - Intergenic
1082237620 11:49838479-49838501 GGGAACTTATAGCGAACAAATGG - Intergenic
1082611002 11:55297428-55297450 GGGAACTTATAGTGAACAAATGG - Intergenic
1082658931 11:55886247-55886269 GGGAACTTATAGTGAACAAATGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083031830 11:59599593-59599615 TGGAACTTGTTGGAACACAAAGG + Intronic
1083965501 11:66041628-66041650 TGGAGCTTATGGGGAAACATTGG - Intergenic
1084583599 11:70040184-70040206 TGCAGCTCATTGGGAAAATATGG + Intergenic
1085272091 11:75276413-75276435 TCCAACTCATTGGGAAAAAGGGG - Intronic
1085983389 11:81752874-81752896 TGTAACTAATTAGGACAAAAGGG + Intergenic
1086401418 11:86463766-86463788 TGGACCATAATGGGGAAAAAAGG + Intronic
1086696719 11:89855771-89855793 AGGAACTTATAGTGAACAAATGG + Intergenic
1086709439 11:89988719-89988741 AGGAACTTATAGTGAACAAATGG - Intergenic
1087094852 11:94308331-94308353 TGTCACTTATTGAAAAAAAAAGG - Intergenic
1087127239 11:94640172-94640194 TGGTATTTATTGGGCGAAAAGGG - Intergenic
1087176513 11:95100950-95100972 TGCAACTTATTAGCAAAGAAAGG - Intronic
1087383794 11:97443734-97443756 TGGAACTCATTGGGATGAATTGG - Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1088282609 11:108150798-108150820 TGAAAATTCTGGGGAAAAAATGG - Intergenic
1088673835 11:112171090-112171112 TTGAAAATATTTGGAAAAAAAGG + Intronic
1090889087 11:130907138-130907160 TGGAACACAAGGGGAAAAAATGG - Intronic
1091516353 12:1186665-1186687 TAGAACTTAATGGGTAAGAAAGG + Intronic
1091708090 12:2713715-2713737 TGTACCTTTTTGGGAAAGAATGG - Intergenic
1092552590 12:9520287-9520309 TTAAACTGATTGGGAAAAGAGGG + Intergenic
1092670460 12:10855508-10855530 AGGAACTTATTGGGAACAACTGG + Intronic
1092720493 12:11435929-11435951 TGGAATTTATTGGGCAAAAAGGG + Intronic
1092823853 12:12378665-12378687 AGGATGTTAGTGGGAAAAAAGGG + Intronic
1093115788 12:15209174-15209196 AGGAACATAAGGGGAAAAAATGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093527697 12:20121862-20121884 TGGCACTTAAGGGGTAAAAAAGG + Intergenic
1093723399 12:22473457-22473479 TGGAACGTTTTGGGGAATAATGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094519526 12:31170330-31170352 TTAAACTGATTGGGAAAAGAGGG - Intergenic
1095080624 12:37995394-37995416 TGAGGCTTATGGGGAAAAAAAGG + Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095520111 12:43053357-43053379 TTGAACTTATTGGGAGAATCTGG - Intergenic
1095828839 12:46561273-46561295 TAGAAATAAGTGGGAAAAAATGG + Intergenic
1096140039 12:49235182-49235204 TGCAACTTATTCGAATAAAAAGG + Intronic
1096728979 12:53590734-53590756 TGGAAATTGCTGGAAAAAAATGG - Intronic
1097806124 12:63966941-63966963 TGGAAATTCTTAGGAAAAAAAGG - Intronic
1097951082 12:65428884-65428906 TCTATCTTATGGGGAAAAAAAGG - Intronic
1097963910 12:65558810-65558832 TGCAACTAAAGGGGAAAAAAAGG + Intergenic
1098336305 12:69408447-69408469 CAGAAATTATTGGGAAATAAAGG + Intergenic
1098342011 12:69461765-69461787 TGGAAATTATAGGAAAATAAGGG - Intergenic
1099353495 12:81604253-81604275 TGGAAATGGTTGGGAAAATATGG + Intronic
1099925393 12:89010536-89010558 GGGAAACTATTGAGAAAAAATGG - Intergenic
1101047524 12:100825007-100825029 TGGAACTTTTTGTTATAAAATGG + Intronic
1101231327 12:102744643-102744665 TGGAACTCAATGAGAAAATAAGG + Intergenic
1101684797 12:107008390-107008412 TGGAGCTTATTGAGAAAGAGTGG + Intronic
1101864024 12:108506694-108506716 TGGAGCTTATTAAGAACAAAGGG + Intergenic
1101905365 12:108820776-108820798 TGGTAATTCTAGGGAAAAAAAGG + Intronic
1105542097 13:21324694-21324716 TTGATCTTATTGGGATAACATGG + Intergenic
1105885731 13:24639545-24639567 TGGAATTCATTGGGTAAAAAGGG + Intergenic
1106189380 13:27437912-27437934 TGGAACTCATTAAGAAAAAAAGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1107455905 13:40554271-40554293 AGAAAATTATTGGGAAAAAGCGG - Intergenic
1108000318 13:45900260-45900282 TGGAATTTTTTGGGCAAAAGGGG + Intergenic
1108871150 13:54988024-54988046 CAAAACTTATTGGGCAAAAAAGG + Intergenic
1108932509 13:55844157-55844179 GGGAATTTGTAGGGAAAAAAAGG - Intergenic
1110094458 13:71499048-71499070 TGAAATTTCTTGGAAAAAAATGG + Intronic
1110198198 13:72815571-72815593 TGCAAATTATCAGGAAAAAAAGG - Intronic
1110413327 13:75226493-75226515 TGGGATTTATTGGGCAAAAAAGG - Intergenic
1110491407 13:76112642-76112664 GAGATCTTAGTGGGAAAAAAAGG + Intergenic
1110816815 13:79870340-79870362 AGAAACTTAGTGGGATAAAAGGG - Intergenic
1111188911 13:84782256-84782278 TGGAAAGTATTTGGAACAAAGGG + Intergenic
1111202228 13:84954048-84954070 TTGAATTTATTGGGCAAAAAGGG + Intergenic
1111780902 13:92722421-92722443 TGGAACCTATTGGCAGAAAAAGG + Intronic
1112121372 13:96415673-96415695 AGAATCTTACTGGGAAAAAAAGG + Intronic
1112826209 13:103395114-103395136 TAGAACTTATTGGGCAAATAAGG - Intergenic
1113997877 14:16103074-16103096 TGGAATTGATTGGGAACAAATGG - Intergenic
1115363752 14:32533298-32533320 AGGCACCTACTGGGAAAAAAGGG + Intronic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1116251632 14:42491750-42491772 TAGAAACTATGGGGAAAAAAGGG - Intergenic
1116531818 14:45980924-45980946 GGGCACTTATTGGAAAATAATGG - Intergenic
1116570070 14:46505261-46505283 TGAAACTAATAGGCAAAAAAGGG - Intergenic
1116676856 14:47917562-47917584 TGAAATTTATGGGAAAAAAAGGG + Intergenic
1117056800 14:51920474-51920496 TTGAAAATATTTGGAAAAAATGG - Intronic
1117285007 14:54278459-54278481 TGGGTTTTATTGGGTAAAAAGGG - Intergenic
1117725262 14:58667078-58667100 TGGTATTTATTAGGTAAAAATGG + Intergenic
1118588410 14:67379560-67379582 GGGGTCTTATTGGGAATAAAAGG - Intronic
1118739865 14:68731485-68731507 GGGAACTAATTGGGAAAGACAGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119502258 14:75139743-75139765 AGGTACTTATTAGGCAAAAATGG - Intronic
1120199627 14:81522927-81522949 TTGAAAATATTTGGAAAAAATGG - Intronic
1120296065 14:82642693-82642715 CGGAACTTCTTGGGTGAAAAGGG - Intergenic
1121218598 14:92267615-92267637 GTGATCTTATTTGGAAAAAAGGG - Intergenic
1122523748 14:102364782-102364804 TGGAACTTAGTGGGAAGAAAAGG + Intronic
1124599462 15:31120285-31120307 TGGAACTTATTGGGATAAATAGG + Intronic
1125366087 15:38917918-38917940 TGGAAATTATTCTGAAGAAATGG + Intergenic
1125440118 15:39692840-39692862 TGGATCTGAATGGGAAGAAAGGG + Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126440954 15:48687894-48687916 TGGAAAATCTAGGGAAAAAATGG + Intergenic
1126637628 15:50794665-50794687 TGAAAATATTTGGGAAAAAAAGG + Intergenic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1130624687 15:85501918-85501940 TGGAATTTGTTGGGAAGAAGGGG + Intronic
1131327174 15:91459258-91459280 TGAAACTCATTGGGGAAAGAGGG - Intergenic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1132042813 15:98539072-98539094 TGGATCTGGTTAGGAAAAAAGGG + Intergenic
1133527664 16:6621565-6621587 GTGACCTTATTTGGAAAAAAGGG - Intronic
1134026856 16:10960971-10960993 GGCAATTCATTGGGAAAAAAGGG - Intronic
1134337775 16:13317159-13317181 GGGAGCTTGTTGGGAGAAAAAGG + Intergenic
1135837039 16:25835906-25835928 GAGAACTTAGTGGGAAAATAAGG + Intronic
1135860148 16:26048962-26048984 TGTCCCTTATTGAGAAAAAACGG + Intronic
1136740847 16:32524034-32524056 TGGAAGTCAATGGCAAAAAAGGG - Intergenic
1138943087 16:61813686-61813708 AGGATTTTATTGGGCAAAAAGGG - Intronic
1139986032 16:70899236-70899258 ATGACCTTATTTGGAAAAAAGGG + Intronic
1140661187 16:77192452-77192474 TGGAAATCAATGGGAATAAATGG + Intronic
1141870750 16:86783926-86783948 TGGAACTTCTTAGTAAACAAAGG + Intergenic
1142055857 16:87995453-87995475 TTCTACTTATTAGGAAAAAATGG - Intronic
1203028755 16_KI270728v1_random:551199-551221 TGGAAGTCAATGGCAAAAAAGGG + Intergenic
1203042966 16_KI270728v1_random:783232-783254 TGGAAGTCAATGGCAAAAAAGGG - Intergenic
1144116759 17:12101965-12101987 AGGAACTAATTGGGAAAGAAAGG - Intronic
1145194350 17:20875870-20875892 TGAAAATTAATAGGAAAAAAAGG - Intronic
1145335052 17:21905377-21905399 TGGAATTTATTCGGATAGAATGG + Intergenic
1145340005 17:21946045-21946067 TGGAACGGATTGGAACAAAATGG + Intergenic
1145341060 17:21954994-21955016 TGGAACTTATTTGAATAGAAAGG + Intergenic
1145341279 17:21956847-21956869 TGGAATTTATTCGAAAAGAATGG + Intergenic
1145342529 17:21967480-21967502 AGGAATTTATTGGGATAGAATGG + Intergenic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1145697836 17:26803481-26803503 TGGAATTTATTCGAATAAAATGG + Intergenic
1145701062 17:26830560-26830582 TGGAACTTATTTGAATAGAATGG + Intergenic
1145703457 17:26850906-26850928 TGGAATTTATTTGAAAAGAATGG + Intergenic
1145705651 17:26869272-26869294 TGGAATGGATTGGAAAAAAATGG + Intergenic
1145706853 17:26878917-26878939 TGGAACGGAATGGGAAGAAATGG + Intergenic
1146212190 17:30951322-30951344 GGGAAACCATTGGGAAAAAAAGG - Intronic
1147519527 17:41156992-41157014 TGAGGATTATTGGGAAAAAAAGG + Intergenic
1147730018 17:42593857-42593879 TGTTACTTAGGGGGAAAAAAGGG - Intronic
1149056818 17:52376468-52376490 AGGAAGTCATTGGGCAAAAAGGG - Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1149205062 17:54234240-54234262 TGTAACTTAAAGAGAAAAAATGG - Intergenic
1149270475 17:54971650-54971672 TGGAAATGATTGGGACAAATGGG - Intronic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150089069 17:62304979-62305001 AATAACTTATGGGGAAAAAAAGG - Intergenic
1150372664 17:64654118-64654140 AGAAACTTTTTGGGAAGAAATGG + Intronic
1150779663 17:68110720-68110742 GGAAACTTTTTGGGAAGAAATGG - Intergenic
1203173977 17_GL000205v2_random:178099-178121 TAGAACTTTTTGGGAAGTAAGGG + Intergenic
1203194263 17_KI270729v1_random:217238-217260 TGGAATTGATTGGAATAAAACGG + Intergenic
1203194584 17_KI270729v1_random:219855-219877 TGGAATTTATTCGGAAGGAATGG + Intergenic
1203199663 17_KI270729v1_random:264097-264119 TGGAATAGATTGGAAAAAAATGG + Intergenic
1203199876 17_KI270729v1_random:265816-265838 TGGAACTTATTCGAATAGAAAGG + Intergenic
1203200428 17_KI270729v1_random:270408-270430 TGGAACTTATTCGAATAGAATGG + Intergenic
1203201065 17_KI270729v1_random:275706-275728 TGGAACTTATTCGAATAGAAAGG + Intergenic
1203203625 17_KI270730v1_random:16664-16686 TGGAATTGATTGGAATAAAACGG + Intergenic
1203203941 17_KI270730v1_random:19261-19283 TGGAATTTATTCGGAAGGAATGG + Intergenic
1203209258 17_KI270730v1_random:64806-64828 TGGAATAGATTGGAAAAAAATGG + Intergenic
1203209471 17_KI270730v1_random:66525-66547 TGGAACTTATTCGAATAGAAAGG + Intergenic
1203210023 17_KI270730v1_random:71109-71131 TGGAACTTATTCGAATAGAATGG + Intergenic
1203210659 17_KI270730v1_random:76407-76429 TGGAACTTATTCGAATAGAAAGG + Intergenic
1153132541 18:1872690-1872712 TGGAACCTATTGGTAAAATATGG + Intergenic
1153677509 18:7468556-7468578 TGAAACCTCCTGGGAAAAAATGG - Intergenic
1156160775 18:34355419-34355441 TGGAGGTTCGTGGGAAAAAATGG + Intergenic
1156269561 18:35518275-35518297 TTGAACTCATTGGGAAACATTGG + Intergenic
1156525928 18:37767244-37767266 AGGAACTTATTGGACAATAAAGG - Intergenic
1158775067 18:60568155-60568177 TGGAAGTTATAGGAAAAAGAAGG + Intergenic
1159168972 18:64737943-64737965 TGAAACTTATTGGAAAAAATTGG - Intergenic
1159195157 18:65103960-65103982 TGGATCTTTCAGGGAAAAAAAGG + Intergenic
1159554323 18:69929389-69929411 TGGAGCATATAGGGAGAAAAAGG - Intronic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1165043774 19:33087905-33087927 TGGAATTTAGTGGGAAAAGAGGG + Intronic
1165056546 19:33180377-33180399 TTGATCTTAAAGGGAAAAAAAGG + Intronic
1165887761 19:39091128-39091150 TGGAACTTATTGTGGGAAATAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167408770 19:49332655-49332677 GTGACCTTATTTGGAAAAAAGGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168552680 19:57310824-57310846 TGGGACTGATTGAGAAAAGAAGG + Intergenic
926239174 2:11071582-11071604 TGGAATTTATTGGGTGAAAAAGG - Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
926963980 2:18389694-18389716 TGGCGATTATTGGGCAAAAAAGG - Intergenic
927822819 2:26283599-26283621 TAAAACTTATAGGAAAAAAATGG - Intronic
928131224 2:28651973-28651995 TTGAACTCATTTGCAAAAAATGG - Intergenic
929237999 2:39626712-39626734 TGGAATTTATTAGGCAAAAAGGG + Intergenic
930133468 2:47877417-47877439 TGTTGCTTAGTGGGAAAAAATGG - Intronic
930316113 2:49798975-49798997 TGGAACATATTGGAGAAAATAGG + Intergenic
930604655 2:53481031-53481053 AGGAACTTAGTATGAAAAAAGGG + Intergenic
930860498 2:56066787-56066809 TGGAATAGATTGAGAAAAAATGG + Intergenic
930981691 2:57533503-57533525 TGGAAAATATAGGGAACAAAAGG + Intergenic
931075015 2:58701154-58701176 TGGCACTTATTAGGTAAAGATGG + Intergenic
931628797 2:64281243-64281265 TAGAAAATATTTGGAAAAAAAGG + Intergenic
931974842 2:67631849-67631871 TTGAATTAATGGGGAAAAAAAGG - Intergenic
932076734 2:68671421-68671443 TGGTAAGTATTGTGAAAAAAAGG + Intergenic
933060352 2:77728912-77728934 TGAAATTTAAAGGGAAAAAAAGG + Intergenic
933649952 2:84842482-84842504 GGGAAGTTAATGTGAAAAAATGG + Intronic
934909581 2:98238883-98238905 TGGAAATTTTAGGGAAAAAAAGG + Intronic
934931556 2:98429824-98429846 AGGATTTTATTGGGCAAAAAGGG - Intergenic
934932398 2:98437098-98437120 AGGATATTATTGGGCAAAAAAGG - Intergenic
935338099 2:102035327-102035349 TGGAATTTATTGGGCAAAAAGGG - Intergenic
935344423 2:102092727-102092749 TGGAATTTACTGGCAAAACAGGG + Intronic
935647083 2:105346838-105346860 TGGAAATCAGTGGGAAAATAGGG + Exonic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
935959576 2:108411370-108411392 TGAAAATATTTGGGAAAAAATGG + Intergenic
936156894 2:110052952-110052974 AGGAGCTTATTGGACAAAAAGGG + Intergenic
936187800 2:110318492-110318514 AGGAGCTTATTGGACAAAAAGGG - Intergenic
937320772 2:120959409-120959431 TGTAACTGACTGGGAACAAAGGG - Intronic
937619864 2:123973013-123973035 TTGATCTCATTGGAAAAAAATGG + Intergenic
939161767 2:138598916-138598938 AGGAACTTAATGGAAAAAAGTGG - Intergenic
940162742 2:150730965-150730987 AGGAATCTATTGGGATAAAATGG - Intergenic
941249958 2:163148863-163148885 TGGGATTTATTGGGCAAAAAGGG - Intergenic
941506805 2:166356487-166356509 TGCTATTTATGGGGAAAAAATGG - Intronic
941578376 2:167264836-167264858 GGGACTTTTTTGGGAAAAAATGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941689545 2:168484973-168484995 TGGAAGTTAATGAGAAAAGAAGG + Intronic
942923348 2:181403728-181403750 TGGAAGTTCTGGGGAAAAGAAGG + Intergenic
942987493 2:182160758-182160780 GGGAATTTATTGGGGAAAATTGG - Intronic
943922138 2:193722583-193722605 TGTAAGTTATTGAGAAATAAAGG + Intergenic
945839403 2:214869706-214869728 TGGAACTTATGGTGAAGAAGTGG + Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
946383268 2:219364056-219364078 TGGAGTTTATTGGGCAAGAAGGG + Intergenic
947273771 2:228368790-228368812 TGGAACTGAGGGGGAAAAAAAGG + Intergenic
947514354 2:230789067-230789089 TGAAACTTAGGGGGGAAAAAGGG - Intronic
947922964 2:233894202-233894224 GGGTATTTATTGGGAAAGAATGG + Intergenic
1169620822 20:7504672-7504694 TTGACCTTATAGAGAAAAAAGGG + Intergenic
1170463811 20:16604512-16604534 TGCAACTTATTGTGAAATATCGG + Intergenic
1171193245 20:23176666-23176688 TTGAAGATATTGTGAAAAAATGG - Intergenic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1171923490 20:31169985-31170007 TGGAACGTAGTGGAAAAAATTGG + Intergenic
1173816323 20:45991336-45991358 GTGACCTTATTTGGAAAAAAGGG - Intergenic
1174711550 20:52711379-52711401 AGGAACTTACTGGGAAACAGTGG - Intergenic
1174791324 20:53481111-53481133 TAGAACAGATTGAGAAAAAAAGG - Intronic
1176329967 21:5539743-5539765 TAGAACTTTTTGGGAATTAAGGG + Intergenic
1176397790 21:6281208-6281230 TAGAACTTTTTGGGAATTAAGGG - Intergenic
1176439367 21:6707896-6707918 TAGAACTTTTTGGGAATTAAGGG + Intergenic
1176463629 21:7034965-7034987 TAGAACTTTTTGGGAATTAAGGG + Intergenic
1176487190 21:7416744-7416766 TAGAACTTTTTGGGAATTAAGGG + Intergenic
1176526821 21:7925890-7925912 TGGAATTTATTCGAAAAGAATGG - Intergenic
1176527382 21:7930479-7930501 TGGAACTGACTGGAACAAAATGG - Intergenic
1176754233 21:10713900-10713922 TGGAATGTATTGGGAAAGAATGG - Intergenic
1177324002 21:19559950-19559972 TGCAACTTAGAGGGGAAAAAAGG - Intergenic
1178044318 21:28676756-28676778 TGGAATTTATTGGGCAAAAGGGG - Intergenic
1178169658 21:30026036-30026058 TGGAACTTTTTGGTCAAAAAGGG + Intergenic
1178417621 21:32416653-32416675 TTGAACTTCTTGGAGAAAAAAGG - Intronic
1178764197 21:35433666-35433688 GGGCACTGATTGGGAAAGAAAGG - Intronic
1179094961 21:38305662-38305684 TGTAATATATGGGGAAAAAAAGG - Exonic
1179470784 21:41608802-41608824 TGTAATATACTGGGAAAAAAAGG + Intergenic
1182893222 22:33836572-33836594 TGGAACTTGGTGGGAACAGAGGG - Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949191548 3:1255456-1255478 TGGAGCCTATTGAGGAAAAAAGG + Intronic
949380725 3:3442757-3442779 CTGAACTTATTTGAAAAAAATGG - Intergenic
949576003 3:5339787-5339809 TGGGAATTATTGGGAGGAAAAGG + Intergenic
949610679 3:5700165-5700187 TTTAATTTATAGGGAAAAAATGG + Intergenic
949623521 3:5843717-5843739 TGGAAGAATTTGGGAAAAAAAGG - Intergenic
949720610 3:6985654-6985676 TGGAGCTTAGTTGGAAAATATGG - Intronic
951792454 3:26501389-26501411 GGGCACTAATTGGGAAGAAATGG + Intergenic
951889367 3:27554054-27554076 TGGAACGTAGTTGGTAAAAATGG - Intergenic
952483285 3:33784338-33784360 TAGAACTGAAAGGGAAAAAAAGG + Intergenic
952636996 3:35544942-35544964 TTGAATTTATTGGGTAAAAAAGG + Intergenic
953674515 3:44990352-44990374 TTGAACTTATTGACAAAATAAGG - Intronic
954968651 3:54633488-54633510 TCGGATTTATTGGGCAAAAAGGG + Intronic
955037509 3:55283330-55283352 TGGAACGTATTGGGCGAAAAGGG - Intergenic
955529711 3:59860431-59860453 TGGAACTTGTAGGGAAAAGAAGG + Intronic
955922930 3:63976780-63976802 TGAGGCTTATTGGGAAAACAGGG + Intronic
956247715 3:67202935-67202957 TGGGATTGATTGGGCAAAAAAGG - Intergenic
956934757 3:74087995-74088017 TGCAACTTAATGTGAAAATAAGG + Intergenic
956959700 3:74384584-74384606 AGGAATTTATTTGGAAAATAGGG - Intronic
958548399 3:95587425-95587447 TGGAAAATATTGGGAAGAAAAGG - Intergenic
959238740 3:103760318-103760340 TTGTACTTAATGGGAAACAAGGG + Intergenic
959468495 3:106720399-106720421 TGAAGTTTATTAGGAAAAAATGG - Intergenic
960437572 3:117645838-117645860 TTAAACTTAGTGGGAAAAAGAGG + Intergenic
960504690 3:118478622-118478644 TGGAATTTATTGGGTGAAAAGGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961841572 3:129718035-129718057 TGAAACAATTTGGGAAAAAATGG + Intronic
962127072 3:132631766-132631788 TGGAAGTAATTGTGATAAAAAGG + Intronic
963843121 3:150128418-150128440 TGGAACCTTTTGGGAAAAGAAGG + Intergenic
964157851 3:153607077-153607099 TATAACTTATTAGGGAAAAAAGG + Intergenic
964903620 3:161691733-161691755 TGGAAATTATTTGGTGAAAATGG - Intergenic
965500994 3:169456450-169456472 TGGAACCTAGTGGGAAATAAGGG + Intronic
967706818 3:192660791-192660813 TGGAAATTATTGGGGAATAAGGG + Intronic
967820830 3:193837282-193837304 AAGAACTTATTGGGGAAAATAGG - Intergenic
968215438 3:196885812-196885834 TGGAACTTTTTTGGAATCAAGGG - Exonic
969843786 4:9903210-9903232 TCGAATTTATTGGGAAGCAATGG + Intronic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972873976 4:43335293-43335315 TGCATCTTATGGGGAAAGAAAGG - Intergenic
972985795 4:44763012-44763034 TGGTACTCAGAGGGAAAAAAAGG + Intergenic
973226481 4:47790467-47790489 TGGAATTTATCGGGCTAAAAGGG - Intronic
973400098 4:49631898-49631920 TGGAATTTATTGGAAACTAATGG + Intergenic
973400800 4:49636335-49636357 TGGAATTTATTGGAAACTAATGG + Intergenic
973401161 4:49638598-49638620 TGGAATTTATTGGAAAATAATGG + Intergenic
973402020 4:49643843-49643865 TGGAATTTATTGGAAACTAATGG + Intergenic
973402913 4:49649461-49649483 TGGAATTTATTGGAAACTAATGG + Intergenic
974818727 4:67039244-67039266 TGAAAATTTTGGGGAAAAAAAGG - Intergenic
975474724 4:74810528-74810550 TAGAAGTTATTTAGAAAAAAGGG - Intergenic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
976753517 4:88474966-88474988 TGCAACTGTTTAGGAAAAAATGG - Intronic
977149198 4:93488322-93488344 TGTAACTTATTTTGAAAAATGGG + Intronic
977238030 4:94532429-94532451 TGGTATTTATTGGGTAACAAGGG + Intronic
977340968 4:95757069-95757091 TAAAACTTACTGGGCAAAAAGGG + Intergenic
977583963 4:98754852-98754874 TGGTTGTTATTGGGAAAAGATGG + Intergenic
978301896 4:107279040-107279062 TGAAACTTATTTTGAAAAAAGGG + Intronic
978955898 4:114612989-114613011 TAAAACTTACTGGGAAAAAAAGG - Intronic
979577449 4:122311097-122311119 TAGAATATATTTGGAAAAAAAGG + Intronic
979869546 4:125801755-125801777 TATTACTTTTTGGGAAAAAAAGG + Intergenic
980531568 4:134062887-134062909 TGTAACCTATTTGGAGAAAAAGG + Intergenic
980613275 4:135185250-135185272 AGGATTTTATTGGGCAAAAACGG + Intergenic
980684507 4:136209056-136209078 TGGCATTTATTGGGAAAACGAGG - Intergenic
980782096 4:137504247-137504269 AGGATCTTATTTGGAAAAAATGG + Intergenic
981034320 4:140153678-140153700 TGGAATTTATTAGAAAATAATGG - Exonic
981324717 4:143432451-143432473 CAGAATTTATTGGGCAAAAAGGG + Intronic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981477637 4:145203686-145203708 TGGAGCTTATTACTAAAAAAAGG + Intergenic
982176005 4:152706217-152706239 TGGAACTTATACTGCAAAAATGG + Intronic
982240759 4:153297110-153297132 TGGAACGTCTTGGGAAATGAAGG + Intronic
984207146 4:176798923-176798945 TGAAACTAAAGGGGAAAAAAAGG + Intergenic
984414913 4:179446051-179446073 TAGAACTTATTGGGCAAAAGGGG + Intergenic
985642039 5:1068026-1068048 TGGCACTGATTGGCATAAAAGGG - Intronic
986213319 5:5694704-5694726 AAGAATTTATTGGGCAAAAATGG - Intergenic
987570386 5:19649782-19649804 TGGAAGTTTTAGGAAAAAAAAGG - Intronic
987668005 5:20969846-20969868 TGGAATTTAGTGGTAGAAAAGGG - Intergenic
987817715 5:22924676-22924698 TGAAACTAATTTGAAAAAAAAGG + Intergenic
988849356 5:35163204-35163226 TGAAATTTATTGGGCAAAAATGG - Intronic
989673653 5:43948895-43948917 TGGAATTCATTAGGAAAGAAGGG - Intergenic
992099846 5:73396469-73396491 TGGAACTTAAGGGGTGAAAATGG + Intergenic
993067200 5:83114523-83114545 AGGAACTTGTTGGGAACTAAAGG - Intronic
993109553 5:83640102-83640124 TAGAACTCATTGTGAAACAATGG + Exonic
993414434 5:87609142-87609164 GGGAACTTGTTGGTCAAAAATGG - Intergenic
993427345 5:87784150-87784172 TGGAACAAATTAGGAAAATAAGG + Intergenic
993472679 5:88324921-88324943 TGAAAATTATAGGGAAAAGAGGG + Intergenic
993615656 5:90108797-90108819 GGAAACTTATAGGGAACAAAAGG - Intergenic
993698279 5:91087896-91087918 TGGAATTTATTCACAAAAAAAGG - Intronic
994617937 5:102129683-102129705 TGTAACTTATTGAAATAAAATGG - Intergenic
994739882 5:103604732-103604754 TGGCACTTATTGGGTAGTAATGG - Intergenic
994921231 5:106046624-106046646 AGTAACTTATTTGGAAATAATGG + Intergenic
995883314 5:116866558-116866580 TTTAACTCATAGGGAAAAAAAGG - Intergenic
996236035 5:121130367-121130389 AGTAACATATTGAGAAAAAATGG + Intergenic
996453786 5:123656925-123656947 AGGAACTTATTGGGAACTAAAGG - Intergenic
996623778 5:125543666-125543688 TAAAACTTTTGGGGAAAAAAAGG - Intergenic
996709057 5:126525903-126525925 TTGAATTTATTAGGCAAAAAAGG - Intergenic
996818943 5:127604169-127604191 TAGAACTTATTAGTAAATAAAGG - Intergenic
997519293 5:134512362-134512384 TTGAATTTGTTGGGAAGAAAGGG + Intergenic
998708300 5:144790651-144790673 TGAAAATATTTGGGAAAAAATGG - Intergenic
998991400 5:147821764-147821786 CGGAATTTATCGGGCAAAAAAGG + Intergenic
999436725 5:151568976-151568998 TGCAAGTTAGGGGGAAAAAATGG + Intergenic
1001170581 5:169415608-169415630 TGGAGCTTACAGGGAGAAAAAGG - Intergenic
1001174488 5:169453880-169453902 TGGAAATTATTAGGAAAAAAGGG - Intergenic
1002316124 5:178344685-178344707 TCAAACATATTAGGAAAAAATGG - Intronic
1002364524 5:178699716-178699738 TGGTACTTATTTAGAAAATAAGG - Intergenic
1003609714 6:7600126-7600148 TTGAATTAATGGGGAAAAAAGGG - Intronic
1003731571 6:8830355-8830377 TGGAAAATAAGGGGAAAAAAAGG - Intergenic
1004658546 6:17688953-17688975 TTTAACATACTGGGAAAAAATGG - Intronic
1005167039 6:22936816-22936838 TGGAGCTTACAGGGTAAAAAAGG - Intergenic
1005236519 6:23768625-23768647 TGGTAGTTATTTGGTAAAAAAGG - Intergenic
1005465171 6:26105599-26105621 CCGAACTCATTGGGAAACAATGG + Intergenic
1005564673 6:27078947-27078969 TGGAATTTATTGCGCGAAAAAGG - Intergenic
1005881413 6:30064656-30064678 TGGAACCTATGAGGAAAGAAAGG - Exonic
1005981551 6:30840677-30840699 TGGAATTTTTTGGGTGAAAAAGG + Intergenic
1006976922 6:38111279-38111301 TGAAAATATTTGGGAAAAAATGG + Intronic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1009651889 6:66487085-66487107 TAAAACTTGTTGGAAAAAAAAGG + Intergenic
1009698770 6:67146235-67146257 TTGTACTTATTGGGAAGAATGGG + Intergenic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009840921 6:69073482-69073504 TGGAATTTACTGGGAAAAGAGGG + Intronic
1009887738 6:69644491-69644513 TTAAACTTAATGGGAAAAAGTGG + Intergenic
1009990765 6:70840437-70840459 TGGCCCTTCTTGGAAAAAAATGG - Intronic
1010053046 6:71531001-71531023 TGGAATTTTTGGGAAAAAAAAGG - Intergenic
1010368089 6:75076058-75076080 AGGAATTTATTGGGTGAAAAGGG + Intergenic
1010380730 6:75221487-75221509 GGTAACCTAGTGGGAAAAAAAGG + Intergenic
1010525732 6:76898236-76898258 TGAAAATTTTTGAGAAAAAATGG - Intergenic
1010552068 6:77235991-77236013 GGGAATTGATTGGAAAAAAATGG + Intergenic
1010731621 6:79397202-79397224 TGTAAGTTATTGGGAAAGGAGGG + Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1011404491 6:87003735-87003757 TCAAAATTATTAGGAAAAAAAGG + Intronic
1011507066 6:88057035-88057057 TGGAACTTTTTGGGGAAGCATGG - Intronic
1011987130 6:93462369-93462391 TAGAAAATATTTGGAAAAAATGG + Intergenic
1012086995 6:94840372-94840394 TGGGAGCTAATGGGAAAAAATGG + Intergenic
1012693728 6:102352627-102352649 AGGAATTTATTGGGAAAAAAAGG + Intergenic
1012694166 6:102356151-102356173 TGCAATTTATTGGGCAAAAAGGG + Intergenic
1013311847 6:108901801-108901823 AGGAAATTATTGGGACAAATTGG - Intronic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015628108 6:135202814-135202836 TATAAATTATTGGCAAAAAATGG - Intronic
1015803849 6:137089250-137089272 TAGAACTTATTCAAAAAAAAGGG - Intergenic
1016011897 6:139145744-139145766 GGGAACTTATGGGAAAACAAAGG + Intronic
1016224160 6:141713810-141713832 TTTAATTTACTGGGAAAAAATGG - Intergenic
1016633966 6:146266434-146266456 TGGAACTAATTAAGACAAAAGGG - Intronic
1018330470 6:162722083-162722105 ACAAACTTATTGGGAAGAAATGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020731181 7:11882657-11882679 TGCAACTTGTGGGCAAAAAAAGG - Intergenic
1021180569 7:17500792-17500814 TGGAATGTATTGGGCAAAGAGGG + Intergenic
1021306043 7:19033918-19033940 TGGTTCTTATTGGTAAAAAGGGG + Intronic
1021318362 7:19180040-19180062 TTTTACTTATTGGAAAAAAAGGG - Intergenic
1021944355 7:25711566-25711588 TGGAAATTTTTGGGAAAAATGGG - Intergenic
1022133826 7:27428831-27428853 TGGAAGTTAATGTGGAAAAAAGG + Intergenic
1022322365 7:29299023-29299045 TTGAATTTATTGGGAAAAAAGGG + Intronic
1022420442 7:30215835-30215857 GGGATCTAATGGGGAAAAAAAGG + Intergenic
1022984727 7:35640551-35640573 TCTAACTTATTAGGGAAAAAGGG - Intronic
1023962245 7:44936565-44936587 TGGAGCTTATTTGAAATAAAAGG - Intergenic
1024112605 7:46162392-46162414 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1024151158 7:46572469-46572491 TCGAACTTCTTGAGATAAAAAGG - Intergenic
1024398472 7:48895203-48895225 CAGAATTTATTGGGCAAAAAGGG - Intergenic
1026347630 7:69488279-69488301 TGGAACTTATTTGGAAGACATGG - Intergenic
1027513198 7:79109347-79109369 AGGAACTTATTGGGAACTAGAGG + Intronic
1027527930 7:79294334-79294356 TAGAATTTATTGGGCAGAAAAGG + Intronic
1027771569 7:82413575-82413597 TGGAGCTGTTTGGGAAAGAATGG - Intronic
1027961264 7:84948794-84948816 TGGTATTTATTAGTAAAAAATGG - Intergenic
1027996932 7:85435967-85435989 TGGAAATTATGTGGAGAAAAAGG + Intergenic
1028135534 7:87219936-87219958 GGGAAATTATTGTGTAAAAATGG - Intronic
1028235897 7:88361281-88361303 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1029032416 7:97482849-97482871 GGGAACCTAGTGGGAAAAGAAGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030296720 7:107936077-107936099 TGGAAAGCATTTGGAAAAAATGG + Intronic
1030975182 7:116113203-116113225 ATGAACTTATTTGGAAATAAGGG + Intronic
1031142277 7:117956517-117956539 GTGGACTTATTTGGAAAAAATGG - Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1031941062 7:127789934-127789956 TGGAACTAATTAGAAATAAAAGG - Intronic
1032897714 7:136269937-136269959 TGAAAGTATTTGGGAAAAAATGG + Intergenic
1033380540 7:140812821-140812843 TGGAACTAATCTAGAAAAAAAGG + Intronic
1033866214 7:145692871-145692893 AGGAATTTATTGGGCAAAAATGG - Intergenic
1034114828 7:148575514-148575536 AGTAATTTATTAGGAAAAAATGG + Intergenic
1034586930 7:152101969-152101991 AGCAACTATTTGGGAAAAAAAGG - Intronic
1036933711 8:12980400-12980422 ATGACCTTATTTGGAAAAAAGGG - Intronic
1038161683 8:25045593-25045615 TGGATCTTTTTGGGAGAAGAAGG + Intergenic
1038864970 8:31429775-31429797 TGAAATTTATTGGGCAAAAAGGG - Intergenic
1038903222 8:31867578-31867600 TTGTACTTTTTGGGAAAATAAGG + Intronic
1039375987 8:37034660-37034682 TAGAACTTATTAGGAAAGGATGG - Intergenic
1039384397 8:37119787-37119809 GGAAAGTTATTGGGAATAAAGGG + Intergenic
1041041790 8:53854123-53854145 TAGAACTTTTAGGAAAAAAATGG + Intronic
1041162955 8:55063390-55063412 TGGAACTGATTAGTAATAAATGG - Intergenic
1042108054 8:65349467-65349489 TGAAATTTATTGGGACACAATGG + Intergenic
1042126659 8:65544676-65544698 TATAAGTTATTTGGAAAAAATGG + Intergenic
1042619450 8:70688729-70688751 TGAAATTGATTGGAAAAAAAAGG + Intronic
1043067732 8:75596698-75596720 AGGAAAATATTGGAAAAAAATGG + Intergenic
1043442206 8:80286156-80286178 TTGAAATTATTGGAGAAAAATGG - Intergenic
1043548690 8:81344216-81344238 CGGGTCTTATAGGGAAAAAATGG - Intergenic
1044212810 8:89570387-89570409 TGGAAATTCATGGGAAAAATAGG - Intergenic
1046363110 8:113187174-113187196 TGGAATTTACTGGGTGAAAAAGG - Intronic
1046910969 8:119626373-119626395 TGGAACCTATGTGGAAACAATGG + Intronic
1046975543 8:120272027-120272049 TGGAATATATTGTGAAAGAATGG + Intronic
1047091723 8:121582592-121582614 TGCACCTTATTTGGAAATAAGGG - Intergenic
1047101225 8:121678237-121678259 TGGAAGTTGTTAGCAAAAAATGG + Intergenic
1047231208 8:122999945-122999967 AGGAAATTTTAGGGAAAAAAAGG + Intergenic
1048152443 8:131907126-131907148 TGTAACTCAAGGGGAAAAAAAGG - Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050447421 9:5739859-5739881 AGGCACTGATTGGAAAAAAATGG - Intronic
1050838080 9:10109775-10109797 TGAAACTCATGGGGAAAAATAGG + Intronic
1051387851 9:16529200-16529222 GGTACCTTATTTGGAAAAAAGGG - Intronic
1051466358 9:17382423-17382445 GGGAACATCTTGGGAACAAAAGG + Intronic
1052074232 9:24120840-24120862 GGGCACTTATTGGGTAAAGAGGG + Intergenic
1053588215 9:39482720-39482742 TGGTCGTTATTGGAAAAAAATGG + Intergenic
1054578089 9:66882568-66882590 TGGTCGTTATTGGAAAAAAATGG - Intronic
1054800615 9:69344738-69344760 TGGAACTTATTGGGCAAAGGAGG + Intronic
1055511903 9:77003468-77003490 TGCAACTGATTGGCAAAAATTGG - Intergenic
1056267692 9:84915695-84915717 TTGTACTTAGTGGGAAAAATTGG + Intronic
1056489069 9:87087159-87087181 TGGACCTCATTTGGAAAAAGGGG + Intergenic
1058098201 9:100887487-100887509 TAGAATTCATTGGGCAAAAAAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058609580 9:106761032-106761054 TTGAAGTTATTGTGGAAAAATGG - Intergenic
1058767602 9:108197319-108197341 TGGAAGATACAGGGAAAAAAGGG - Intergenic
1059262811 9:112994583-112994605 AAGAACTGATTGGGAAAAATTGG - Intergenic
1059803339 9:117772987-117773009 AGGAAATTCTGGGGAAAAAATGG + Intergenic
1062438689 9:136559034-136559056 AGGAACTTATTGGGAAAGGGAGG + Intergenic
1203432128 Un_GL000195v1:100583-100605 TAGAACTTTTTGGGAATTAAGGG - Intergenic
1203389193 Un_KI270438v1:81998-82020 TGGAATTTATTCGAATAAAATGG + Intergenic
1203389782 Un_KI270438v1:87046-87068 TGGAATTGATTGGAACAAAATGG + Intergenic
1203392202 Un_KI270438v1:107133-107155 TGGAATTTATTCGAAAACAATGG + Intergenic
1203348585 Un_KI270442v1:57495-57517 TGGAATGTATTGGGAAAGAATGG + Intergenic
1203673715 Un_KI270756v1:3571-3593 TGGAACAGACTGGAAAAAAATGG - Intergenic
1203674716 Un_KI270756v1:12205-12227 TGGAACTTATTCGAATAGAACGG - Intergenic
1203678104 Un_KI270756v1:40400-40422 TGGAATTTACTGGAACAAAATGG - Intergenic
1203679757 Un_KI270756v1:53823-53845 TGGAATTGACTGGAAAAAAATGG - Intergenic
1203679788 Un_KI270756v1:54131-54153 TGGAATTTATTCGAAAAGAATGG - Intergenic
1203680208 Un_KI270756v1:57563-57585 TGGAATGTACTGGAAAAAAATGG - Intergenic
1203680913 Un_KI270756v1:63290-63312 TGGAATTTATTCGAAAAGAATGG - Intergenic
1203681692 Un_KI270756v1:69715-69737 TGGAATTTATTAGAAAAGAATGG - Intergenic
1203682174 Un_KI270756v1:73758-73780 TGGAATGTATTGGAACAAAATGG - Intergenic
1187159360 X:16750018-16750040 TGGAACTTATCAGGACAAACAGG + Intronic
1187642588 X:21311260-21311282 TGGAATTTTTGTGGAAAAAAGGG - Intergenic
1188518149 X:31009648-31009670 TGGAACTTATTGGGCAAAAAGGG - Intergenic
1188647181 X:32583763-32583785 TGGATCTATATGGGAAAAAATGG + Intronic
1188762850 X:34053884-34053906 TTGAATTTATTTGGCAAAAAGGG - Intergenic
1188763359 X:34058490-34058512 TGGAATTATTTGGGCAAAAAGGG - Intergenic
1189616386 X:42788812-42788834 TGGAATTTATTGGGTGAAAAGGG + Intergenic
1190434156 X:50407050-50407072 TGGAACATATTGGAAACTAAAGG + Intronic
1190549454 X:51563726-51563748 TGGAATTTATTGGGTGAAAAAGG + Intergenic
1191606940 X:63072350-63072372 TGGAACTTAGGAGGAAAAAGTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191638159 X:63400682-63400704 CAGAATTTATTGGGCAAAAAAGG - Intergenic
1191645057 X:63471103-63471125 TGAAATTTATTGGGCAAAAATGG + Intergenic
1192880634 X:75279587-75279609 TTGAAATTATTGCAAAAAAATGG - Intronic
1193198895 X:78665182-78665204 AGGAACTTTTTGGGAACTAAAGG + Intergenic
1193269868 X:79516198-79516220 TGGAATTTATTGGGTGAAAAGGG - Intergenic
1193483231 X:82053517-82053539 TGGCACTGAGTGGGAAAAAGTGG - Intergenic
1194320417 X:92440117-92440139 AAGAAATTATTGGAAAAAAATGG - Intronic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194421606 X:93681338-93681360 TGCAATTTATTTGGACAAAATGG + Intronic
1194640167 X:96394452-96394474 TGTAAGTGTTTGGGAAAAAAAGG - Intergenic
1194693637 X:97017790-97017812 TGCCAGTAATTGGGAAAAAAGGG - Intronic
1195400654 X:104457944-104457966 TGGAACTTTTAGTGATAAAACGG + Intergenic
1196037677 X:111164611-111164633 TTGGACATATAGGGAAAAAAGGG - Intronic
1196474823 X:116069980-116070002 TGTAACTTCTTAGGAAAAAGGGG - Intergenic
1196509440 X:116489870-116489892 TGCAATTTATTGGCAAAAATAGG - Intergenic
1197348711 X:125356906-125356928 TGGAATTTATTTGGTAAAAAGGG - Intergenic
1197837051 X:130705906-130705928 TGGAATGTATTGGAGAAAAAGGG - Intronic
1197971316 X:132118394-132118416 AGGATTTTATTGGGCAAAAAAGG + Intronic
1198825109 X:140691159-140691181 TGGAATTTGTAGTGAAAAAAGGG + Intergenic
1199780064 X:151050336-151050358 TGGAACATATTGGGGAAGATGGG - Intergenic
1200415712 Y:2907730-2907752 AGCAAATTATTGGGCAAAAATGG - Intronic
1200785738 Y:7258910-7258932 TGGAATTTATTGGGCAAAAAGGG + Intergenic
1201097367 Y:10631561-10631583 TGGAATTGATTGGGACAGAATGG - Intergenic
1201102995 Y:10692591-10692613 TGCAATGTATTGGGAATAAATGG - Intergenic
1201110994 Y:10799357-10799379 TGGAACTGAATGGAACAAAATGG - Intergenic
1201207769 Y:11649163-11649185 TGGAATTTACTGGAACAAAATGG + Intergenic
1201209519 Y:11666748-11666770 TGGAATTTATTCGAAAAGAATGG + Intergenic
1201217856 Y:11738792-11738814 TGGAATTTATTCAGAAAGAATGG + Intergenic
1201218626 Y:11745392-11745414 TGGAATTTATTGAAAAAGAATGG + Intergenic
1201218942 Y:11748133-11748155 TGGAATTTACTGGAACAAAATGG + Intergenic
1201910478 Y:19128666-19128688 TTGAAGGTATTGGGGAAAAAGGG - Intergenic
1202605709 Y:26638147-26638169 TGGAATGGAATGGGAAAAAATGG + Intergenic
1202607575 Y:26652028-26652050 TGGAACTGAATGGAATAAAATGG + Intergenic