ID: 1093925340

View in Genome Browser
Species Human (GRCh38)
Location 12:24903335-24903357
Sequence CTTCCCGGCCATTCACCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093925340_1093925344 -1 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925344 12:24903357-24903379 GCGCCCCTCGGTCAAGGCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1093925340_1093925348 8 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925348 12:24903366-24903388 GGTCAAGGCTAAGGAAACCTCGG 0: 1
1: 0
2: 2
3: 8
4: 122
1093925340_1093925349 23 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925349 12:24903381-24903403 AACCTCGGAGAAACTACATTAGG 0: 1
1: 0
2: 1
3: 7
4: 78
1093925340_1093925343 -7 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925343 12:24903351-24903373 CGGGAAGCGCCCCTCGGTCAAGG 0: 1
1: 0
2: 0
3: 3
4: 54
1093925340_1093925350 24 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093925340 Original CRISPR CTTCCCGGCCATTCACCTAG AGG (reversed) Intronic
906226003 1:44121933-44121955 CCTACCAGCCATTCACCTACTGG + Intronic
906344154 1:45004791-45004813 CTTCCAGGAGCTTCACCTAGGGG + Exonic
916953644 1:169809018-169809040 CTTCCCTGCCAGTCAGCTATGGG + Intronic
919153615 1:193732232-193732254 CTTGCCTGCCATTCACCTCCTGG + Intergenic
924829505 1:247578360-247578382 CTTCGCTGTGATTCACCTAGAGG - Intergenic
1069747469 10:70724960-70724982 CTTCCCTGCCATTCCTTTAGTGG + Intronic
1078783221 11:14459936-14459958 CTTCTCCCCCATTCAGCTAGAGG - Intronic
1083274933 11:61591447-61591469 CTTCCCGTCCACTCTCCTAAGGG + Intergenic
1084453356 11:69252848-69252870 CTTCCCTGCCATGCCCCAAGGGG - Intergenic
1091760786 12:3085814-3085836 CTTCCCGGCCTCTGACCTGGAGG + Intronic
1092020803 12:5200760-5200782 CGACCCTGCCTTTCACCTAGTGG - Intergenic
1093925340 12:24903335-24903357 CTTCCCGGCCATTCACCTAGAGG - Intronic
1098141889 12:67458065-67458087 CTTCCTGTCCTTTCCCCTAGTGG - Intergenic
1103292218 12:119855745-119855767 ATTTCAGGCCATTCACCTGGAGG + Intronic
1105012080 12:132762357-132762379 CTTCCCGCTCCTTCACCAAGGGG + Intergenic
1113142350 13:107168172-107168194 CTTCCTAGCCATTCCCTTAGAGG + Exonic
1114694682 14:24615471-24615493 TTTCCGGTCCACTCACCTAGTGG + Intergenic
1126718625 15:51551726-51551748 ATCCCCAGCCATTCACATAGTGG - Intronic
1129683117 15:77669442-77669464 TTTCCCTGCCATTCACTCAGGGG - Intronic
1137539932 16:49355286-49355308 CTTCCCAGCCCTTCACCCTGGGG - Intergenic
1138323217 16:56137388-56137410 CTTCACAGCCATTCTCCTAAAGG + Intergenic
1142682592 17:1559104-1559126 CTTCCTGGCCCTTCCCCTGGAGG - Intronic
1143619481 17:8072914-8072936 CTTCCCGGACATTCACTTCGTGG - Exonic
1161124334 19:2547365-2547387 CTTTCCCGCCTTTCGCCTAGAGG + Intronic
1162208876 19:9076070-9076092 CATCACTGCCCTTCACCTAGGGG - Intergenic
1167369549 19:49072465-49072487 CTTCCCGGACACTCTGCTAGGGG - Exonic
932579859 2:72986057-72986079 GTTCCCGGCCATTCAGCTGCAGG - Intronic
937732999 2:125257664-125257686 TCTCCCAGCCATTCAGCTAGTGG + Intergenic
940005140 2:149003320-149003342 CTTCCCGGGCATTCACCCCCTGG - Intronic
1169990411 20:11497065-11497087 CTTCAGGGCCATTCAGCCAGAGG + Intergenic
1171436109 20:25125872-25125894 CTTCCCTGTGATTCACATAGAGG - Intergenic
1173563437 20:44022465-44022487 CTTCCCTGCCAACCACATAGAGG + Intronic
1176259494 20:64172036-64172058 CTTCCTGCCCAGTCACCCAGAGG + Intronic
1179014420 21:37583200-37583222 CTTCCCTGTCTTTCACCCAGTGG + Intergenic
1179422882 21:41250128-41250150 CTTCCTGGCCTTTCTCCTTGTGG - Intronic
1184322928 22:43756824-43756846 CTTCATGGCCCTTCACCTTGTGG - Intronic
957342535 3:78919524-78919546 CTTCCCAGCTATTTACTTAGTGG + Intronic
967425980 3:189328069-189328091 CTACCCAGTGATTCACCTAGAGG - Intergenic
971126664 4:23761972-23761994 CTTCTTGGCCATTGACTTAGAGG - Intronic
980522043 4:133948005-133948027 CTCCCAGGCCATTCAGCTGGTGG + Intergenic
992830706 5:80590742-80590764 CCACCCGGTCATTCACCCAGTGG - Intergenic
995888015 5:116917941-116917963 CTTCCTGGCTATTCACGTAAAGG + Intergenic
1001253053 5:170163124-170163146 CTAGCCAGCCATTCCCCTAGAGG - Intergenic
1006807496 6:36798106-36798128 CTTCCCGCCCATTCTGCTGGGGG - Intronic
1007467206 6:42062060-42062082 TTTCCCTGCCATTCACCCAAAGG + Intronic
1008820387 6:55625077-55625099 CTCCACGGCGATTCACCTATTGG - Intergenic
1010635719 6:78256925-78256947 CTTCCCTGCCCCTCCCCTAGTGG - Intergenic
1013248376 6:108310158-108310180 CTTCCCGGCTTTTGACCTGGGGG + Intronic
1018796172 6:167187113-167187135 GTTCCCGGTCCTTCACCTGGTGG - Intronic
1018820146 6:167367944-167367966 GTTCCCGGTCCTTCACCTGGTGG + Intronic
1025924533 7:65946344-65946366 CTTCCCGACCATCAAGCTAGAGG + Intronic
1027520399 7:79199734-79199756 CTTGCTGTCTATTCACCTAGAGG - Intronic
1038224605 8:25644298-25644320 CTTCCCTGACATGCACCTGGGGG - Intergenic
1049368602 8:142252875-142252897 CTTCCTGGCCACTGCCCTAGTGG + Intronic
1052772611 9:32703552-32703574 CTTCCTGGGCTTCCACCTAGAGG + Intergenic
1057170610 9:92960972-92960994 CTTCCAGGCCTCTCTCCTAGTGG + Intronic
1059690348 9:116679004-116679026 CTTGCCTGCCATTTACCCAGAGG - Intronic
1062544193 9:137054299-137054321 CTTCCCGCCCACTCAGCAAGGGG + Intergenic
1186048390 X:5561977-5561999 CTTCTCCACCATTCACTTAGTGG + Intergenic
1187144925 X:16628814-16628836 CTTCCCTCCCACTCCCCTAGTGG + Intronic
1192362569 X:70448906-70448928 CATCACTGCCATTCACCTAGGGG - Exonic
1196951618 X:120930993-120931015 CTACCCGGCCATTCATCTGCGGG + Intronic
1196952302 X:120935854-120935876 CTACCCGGCCATTCATCTGCGGG + Intronic
1196952987 X:120940715-120940737 CTACCCGGCCATTCATCTGCGGG + Intronic
1196953672 X:120945575-120945597 CTACCCGGCCATTCATCTGCGGG + Intronic
1196954357 X:120950436-120950458 CTACCCGGCCATTCATCTGCGGG + Intronic
1196955040 X:120955296-120955318 CTACCCGGCCATTCATCTGCGGG + Intronic
1196955728 X:120960179-120960201 CTACCCGGCCATTCATCTGCGGG + Intronic
1196956409 X:120965040-120965062 CTACCCGGCCATTCATCTGCGGG + Intronic
1196957091 X:120969900-120969922 CTACCCGGCCATTCATCTGCGGG + Intronic
1196957773 X:120974760-120974782 CTACCCGGCCATTCATCTGCGGG + Intronic
1196958455 X:120979620-120979642 CTACCCGGCCATTCATCTGCGGG + Intronic
1196959136 X:120984480-120984502 CTACCCGGCCATTCATCTGCGGG + Intronic