ID: 1093925342

View in Genome Browser
Species Human (GRCh38)
Location 12:24903350-24903372
Sequence CTTGACCGAGGGGCGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093925342_1093925348 -7 Left 1093925342 12:24903350-24903372 CCGGGAAGCGCCCCTCGGTCAAG 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1093925348 12:24903366-24903388 GGTCAAGGCTAAGGAAACCTCGG 0: 1
1: 0
2: 2
3: 8
4: 122
1093925342_1093925350 9 Left 1093925342 12:24903350-24903372 CCGGGAAGCGCCCCTCGGTCAAG 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1093925342_1093925349 8 Left 1093925342 12:24903350-24903372 CCGGGAAGCGCCCCTCGGTCAAG 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1093925349 12:24903381-24903403 AACCTCGGAGAAACTACATTAGG 0: 1
1: 0
2: 1
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093925342 Original CRISPR CTTGACCGAGGGGCGCTTCC CGG (reversed) Intronic
900100502 1:960257-960279 CGAGACCTAGGGGGGCTTCCCGG + Intergenic
900104472 1:976437-976459 CCAGACCGAGGGGCGCTGGCAGG - Intronic
901046297 1:6398007-6398029 CGTGAGGGAGGAGCGCTTCCAGG - Intergenic
901050913 1:6425459-6425481 CATCACCCAGGTGCGCTTCCAGG - Intronic
923629103 1:235637999-235638021 CTTGACCAAGAAGAGCTTCCCGG + Intronic
1064147331 10:12835905-12835927 CATGACTCAGAGGCGCTTCCTGG - Intergenic
1067341444 10:45408371-45408393 CTTGGGGGAGGGGAGCTTCCAGG + Intronic
1072001526 10:91200085-91200107 CTTGACTGAGGGCTGTTTCCTGG + Intronic
1074116317 10:110459818-110459840 CCTGACGGAGGGGCTGTTCCAGG - Intergenic
1077440526 11:2566752-2566774 CTTGACCCCGGGGGGCTTGCAGG + Intronic
1083102727 11:60326743-60326765 CTTGACGGTGGGGCCCTTGCTGG + Intergenic
1083759991 11:64810445-64810467 CTTGACCTGGGTGCGCTTTCTGG - Intronic
1091587219 12:1823095-1823117 CTTGACCAAGGGGAGATGCCAGG + Intronic
1093925342 12:24903350-24903372 CTTGACCGAGGGGCGCTTCCCGG - Intronic
1097086038 12:56469148-56469170 CTTGAATGTGGAGCGCTTCCGGG + Exonic
1105802657 13:23922432-23922454 CATGACTCAGGGGCTCTTCCAGG - Intergenic
1136619159 16:31416514-31416536 CCTGACCGTGGGGAGCTCCCTGG + Exonic
1144254042 17:13447985-13448007 CCTGACCCAGGGGTGCATCCTGG + Intergenic
1146002433 17:29139379-29139401 CCTGAGAGATGGGCGCTTCCTGG - Intronic
1152680284 17:81664322-81664344 CTGGACAGATGGGCACTTCCAGG + Intergenic
1159954630 18:74510563-74510585 CATGACCGAGGGGAGCTTCCAGG - Intronic
1160028483 18:75238564-75238586 CTTTACTGAGGGGCTCTTCGGGG - Intronic
1160909713 19:1468961-1468983 GGTGACCGGGGGGCGCTTTCTGG - Exonic
1161897896 19:7096470-7096492 CGTGACTGAGGGGTGCTTGCTGG - Intergenic
1162339954 19:10086346-10086368 CTGGACCGACGGGCGCACCCAGG + Exonic
1162900859 19:13795050-13795072 GTTTACTGAGGGTCGCTTCCGGG - Intergenic
1167134509 19:47608950-47608972 CATACCCGAGGGGCGCTCCCCGG + Intronic
930747853 2:54903093-54903115 CTTGAACGATGGGAGTTTCCTGG + Exonic
932430959 2:71673269-71673291 CTGGACTGAGGGGTGCTCCCCGG + Intronic
932756996 2:74415861-74415883 GATCACCGAGTGGCGCTTCCTGG - Exonic
937457469 2:122054938-122054960 CTTGACACAGGGCCTCTTCCTGG + Intergenic
938068325 2:128293552-128293574 ATGGTCCGAGGGGCGCTTCCCGG + Intronic
946199113 2:218060932-218060954 CTTGACCAAGTGGCGCTGCTGGG + Intronic
946213350 2:218164750-218164772 CTTGACCAAGTGACGCTTCTGGG + Exonic
1176113474 20:63421180-63421202 CTTGACCAAGAGGCCCCTCCCGG + Intronic
1179290389 21:40013244-40013266 CAGGACCGTGGGGCGCTTCAGGG + Exonic
1180997539 22:19972924-19972946 TTGGACCAAGGCGCGCTTCCAGG - Exonic
953766521 3:45747327-45747349 CTTGACCAAGGGGCACCTGCAGG - Intergenic
959866851 3:111280794-111280816 CTTTACCCACGGGTGCTTCCAGG + Intergenic
968402667 4:312077-312099 CTTGACTGGGGGGCTCTACCAGG + Intergenic
1002455785 5:179344912-179344934 CTTGGCCGCGGGGCTTTTCCCGG + Intronic
1004108899 6:12695014-12695036 CAGGACTGAGGGGCACTTCCTGG + Intergenic
1007299648 6:40857143-40857165 GTTGACCCAGGGGTGCTTCTGGG + Intergenic
1009946523 6:70347408-70347430 CCTGACCCAGGGGCCCTACCTGG + Intergenic
1019277626 7:184189-184211 CCTGACCGAGGGACGCCTCGAGG - Intergenic
1020023552 7:4883381-4883403 CTGGACCGGGGGGCGGTACCCGG - Intronic
1026389961 7:69890746-69890768 CTTGACTGAGGAGCACTGCCTGG - Intronic
1029708184 7:102286414-102286436 CGTCAGCGAGGGGCGCTTCGAGG + Intronic
1033822192 7:145148131-145148153 CTTGACAGAGCGGCCCTACCTGG - Intergenic
1047512554 8:125526784-125526806 CTTCAGTGAAGGGCGCTTCCTGG + Intergenic
1048269596 8:133017926-133017948 CCTGGCAGAGAGGCGCTTCCAGG + Exonic
1059401041 9:114070894-114070916 CCTGCCCAAGGGGTGCTTCCAGG - Intronic
1061838183 9:133342745-133342767 CTTCACCCAGCGGGGCTTCCAGG - Intronic
1062229019 9:135470871-135470893 CTTGACCGTGGACCACTTCCTGG + Intergenic
1188004866 X:25010259-25010281 CTTGACCGAGGCCCGAGTCCAGG - Exonic
1190243956 X:48678210-48678232 CCTGACTGAGGGTTGCTTCCTGG - Intronic
1190792679 X:53714744-53714766 CTTGACAGAGAGACTCTTCCAGG + Intergenic
1199264961 X:145818497-145818519 CATTTCCGAAGGGCGCTTCCGGG - Exonic