ID: 1093925345

View in Genome Browser
Species Human (GRCh38)
Location 12:24903360-24903382
Sequence TTTCCTTAGCCTTGACCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093925345_1093925349 -2 Left 1093925345 12:24903360-24903382 CCCCTCGGTCAAGGCTAAGGAAA 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1093925349 12:24903381-24903403 AACCTCGGAGAAACTACATTAGG 0: 1
1: 0
2: 1
3: 7
4: 78
1093925345_1093925350 -1 Left 1093925345 12:24903360-24903382 CCCCTCGGTCAAGGCTAAGGAAA 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093925345 Original CRISPR TTTCCTTAGCCTTGACCGAG GGG (reversed) Intronic
901668341 1:10838927-10838949 CTTGCTTGGCCTTGACCGTGTGG - Intergenic
915966060 1:160309294-160309316 TTTTCTTACCCTTCACCCAGAGG + Intronic
916379330 1:164191217-164191239 TTTCCTTATCCTTGACCTTTGGG - Intergenic
919030979 1:192242413-192242435 TTTCCTGAGCCTTGAAGGAATGG - Intergenic
1072208261 10:93223507-93223529 TTTCCTTAACCATGACCAGGAGG - Intergenic
1073874481 10:107906400-107906422 TTTCCCTGGCTTTGGCCGAGTGG - Intergenic
1075296012 10:121275864-121275886 TTTCCTTAGCCGTGTCTGTGGGG - Intergenic
1076406587 10:130216104-130216126 GTCCTTTAGCCTTGGCCGAGAGG + Intergenic
1077684191 11:4275533-4275555 TTTCCTTCACCCTGACAGAGGGG - Intergenic
1077685852 11:4291232-4291254 TTTCCTTCACCCTGACAGAGGGG + Intergenic
1077691001 11:4342392-4342414 TTTCCTTCACCCTGACAGAGGGG + Intergenic
1093925345 12:24903360-24903382 TTTCCTTAGCCTTGACCGAGGGG - Intronic
1094757690 12:33491178-33491200 TTTCTTTAGCCTTGACCTTTGGG - Intergenic
1095038576 12:37419833-37419855 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1096915895 12:55032863-55032885 GTTCCTTAGCTATGACAGAGTGG - Intergenic
1099808391 12:87548546-87548568 TTTCCTTATCCTTGACCTCTGGG - Intergenic
1101162352 12:101992112-101992134 TTTCCTTATCCTTGACCTATGGG + Intronic
1103640450 12:122347276-122347298 TGGCCTGAGCCTTGACCCAGTGG - Intronic
1104382865 12:128323265-128323287 TTTCCTGAGCCTGGACTGATGGG + Intronic
1107552721 13:41492397-41492419 TTTCCTCAGCCCAGACCCAGGGG - Intergenic
1111513132 13:89292738-89292760 TTTCTTTATCCTTGACCTTGGGG + Intergenic
1113146442 13:107213134-107213156 TTTCCTCAGCATTGCCCGATGGG + Intronic
1116382670 14:44290682-44290704 TTTCCTTTGCCTAGACACAGAGG + Intergenic
1117790262 14:59332889-59332911 TTTCCTTGGGCTTTACTGAGAGG + Intronic
1120697624 14:87661353-87661375 TTTCCTTATCCTTGACCTTTGGG - Intergenic
1126617841 15:50604190-50604212 TTTCCTTAGTCTTATCTGAGTGG - Intronic
1130541761 15:84825567-84825589 TTTCCTTAGACTTGTCCAGGCGG + Intronic
1137542573 16:49375089-49375111 TTTCCTTATCCTTCAACTAGGGG - Intronic
1140606134 16:76540873-76540895 TTTCCTTTGCCATGACGAAGTGG - Intronic
1144770574 17:17757280-17757302 TTTCCTGAGCCTGGACTGAGAGG + Intronic
1148551909 17:48555613-48555635 TTTCCTTTGCCTTCAAGGAGGGG - Intronic
1149874652 17:60219627-60219649 TTTCCTCAGCATTTACCGAGAGG - Intronic
1150088441 17:62296866-62296888 TTTCCTCAGCATTTACCGAGAGG - Intergenic
1152321126 17:79609454-79609476 TGTCCTTAGCCTCCACCGTGGGG + Intergenic
1155768101 18:29662092-29662114 TTTGCTTAGCCTTGATGTAGTGG + Intergenic
1165601506 19:37058660-37058682 TTTCCTTGGCGTTGACTGGGAGG + Intronic
926081145 2:9987470-9987492 CTTCCTTAGCTGTGTCCGAGTGG + Intronic
926516459 2:13852424-13852446 TTTCCTTATCCTTGACCTTTGGG - Intergenic
928686940 2:33759582-33759604 TTTCCATAGCAATGACCCAGTGG - Intergenic
931441930 2:62296250-62296272 TTTCCCTGGGCTTGACAGAGTGG - Intergenic
932853421 2:75209671-75209693 TTTCCTCAACCTTGGCAGAGAGG - Intergenic
932951750 2:76301954-76301976 TCTCCTTAGCCAAGACCAAGAGG - Intergenic
933204271 2:79487380-79487402 TTTCCCTAGCCTTGAATCAGTGG + Intronic
934048885 2:88193497-88193519 TTTCCTTAGCCTGTAACGAAAGG + Intergenic
934950464 2:98572099-98572121 TTTCCTTAGCCATGACCTTGAGG + Intronic
937619823 2:123972688-123972710 TTTCCAGAGCCTTTACTGAGAGG + Intergenic
944222994 2:197320880-197320902 TTTCCTTAGCCTAGATTGATAGG - Intergenic
945474348 2:210263913-210263935 TTTTCTTAGCCTTGATGGACAGG + Intergenic
945506123 2:210642384-210642406 CTTCCTTAGCCTGGACTGACTGG + Intronic
1173809702 20:45948358-45948380 TCTCCTGAGCCTTGACTGTGAGG - Intergenic
1176679537 21:9811978-9812000 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1176680960 21:9819018-9819040 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1176682929 21:9828891-9828913 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1176683768 21:9833107-9833129 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1176684324 21:9835919-9835941 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1176684893 21:9838724-9838746 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1179096562 21:38321235-38321257 TTTCCATCTCCTTGACCAAGTGG + Intergenic
1179375410 21:40846567-40846589 TTTCCTTATCATTGACCGGGGGG - Intronic
1180847621 22:18992670-18992692 TGACCTTAGTCTTGCCCGAGAGG + Intergenic
1184307341 22:43614615-43614637 TTTCCTTACCCTGAACCTAGAGG + Intronic
949776076 3:7633883-7633905 TTTTCTTAACCTTGACCTTGGGG + Intronic
953044158 3:39280668-39280690 TGTCCTCAGCCTTGACTGATGGG - Intronic
953104412 3:39861939-39861961 GTTCCTTAACCTTGCCAGAGAGG + Intronic
957434353 3:80154498-80154520 TTTCCTTATCCTTGACCTTTGGG + Intergenic
961365715 3:126398127-126398149 TTCCCTAAGCCTTGGCAGAGGGG + Intronic
967213636 3:187191538-187191560 TTTCCTTTGCTTTGACCCAAAGG + Intergenic
968873010 4:3250963-3250985 TTTTCTGAGCCTTGAAGGAGGGG + Intronic
972011850 4:34192243-34192265 TTTCCTTAGCTTTGAAGGAGCGG + Intergenic
972237280 4:37149297-37149319 TTTCTTTATCCTTGACCTTGAGG + Intergenic
975636601 4:76456533-76456555 TTTCCTTAGCATAAACCCAGAGG - Intronic
977808387 4:101330788-101330810 TTTTCATAGCCTTAACCTAGGGG + Intronic
980010305 4:127587920-127587942 TTTCCTTAACCTTGCTAGAGAGG + Intergenic
980268602 4:130553628-130553650 TTTCCTTAACCTTGACCTTTGGG - Intergenic
980597099 4:134968355-134968377 TTTCCTTATCCTTGACCTCTGGG - Intergenic
981509809 4:145543628-145543650 TATCCTTAGCAGTGACCGAGTGG + Intronic
987873658 5:23651573-23651595 TTTCCTGAGCCTTGAGGGAGTGG - Intergenic
990694024 5:58395210-58395232 TTTCTTTAGCCTTGTTCGTGGGG - Intergenic
994226399 5:97255929-97255951 TTTCTTTAGCCTTGACCTTTGGG - Intergenic
996962340 5:129266155-129266177 TTTCTTTATCCTTGACCTTGGGG - Intergenic
999961676 5:156762804-156762826 TTTCCTCACCCCTGACCTAGAGG + Intronic
1000305767 5:159993296-159993318 TTTCCTGAGCCTTGAGGGACTGG - Intergenic
1000539170 5:162518834-162518856 TTTCTTTATCCTTGACCTATTGG + Intergenic
1001236148 5:170031313-170031335 TTTCATTAGCACTGACAGAGAGG + Intronic
1001762200 5:174217340-174217362 TCTCCTTAGCGTTTACCCAGAGG - Intronic
1002168335 5:177361703-177361725 TTTCCTGAGCTTTGACTGTGTGG - Intronic
1003325916 6:5090660-5090682 TTTCTTCTGCCTTGACCGAGGGG + Intergenic
1004594521 6:17086581-17086603 ATTACTTAGCCCTGACCGACTGG + Intergenic
1011019166 6:82791244-82791266 TTTCTTTATCCTTGACCTATGGG - Intergenic
1012892301 6:104909939-104909961 TTTCTTTATCCTTGACCTTGGGG - Intergenic
1014760675 6:125353371-125353393 TTTCCTCACCCTTGTCTGAGTGG - Intergenic
1016136697 6:140553348-140553370 TTTCTTTATCCTTGACCTATGGG + Intergenic
1016615519 6:146043182-146043204 TTTCCTTAGCCTCCACCTACAGG - Intronic
1023039056 7:36156287-36156309 TTTCCTTGGCACTGACCCAGTGG + Intronic
1025294908 7:57769503-57769525 TTTCCTTAGCATTGATGGAAAGG + Intergenic
1028308123 7:89291845-89291867 TTTCCTTATCCTTGACCTTTGGG - Intronic
1030752693 7:113249756-113249778 TTTCTTTATCCTTGACCTTGGGG - Intergenic
1031331116 7:120465904-120465926 TTTCCTTAAGCTTGACCTGGAGG + Intronic
1032524603 7:132570436-132570458 ATTCCTTGGCTTTGACCCAGAGG - Intronic
1037274109 8:17159066-17159088 TTTGCATAGCCTTGGTCGAGTGG + Intronic
1043600409 8:81930034-81930056 TTTCTTTAGCCTTGACCTTTGGG - Intergenic
1044241674 8:89894958-89894980 TTTCCTTATCCTTGACCTTCGGG - Intergenic
1045223530 8:100222041-100222063 CTTCCTTGGCCTTGACCAGGCGG + Intronic
1047934413 8:129762715-129762737 TCTCCTTGGCCTTGACCCTGGGG + Exonic
1049671896 8:143873654-143873676 CATCCTTAGCCCTGCCCGAGGGG + Intronic
1050221898 9:3400622-3400644 TATCTTCAGCCTTGACAGAGAGG + Intronic
1050514843 9:6432518-6432540 TTTCATTAGCTTTAACCTAGAGG + Intronic
1050644070 9:7700658-7700680 TTTCTTTATCCTTGACCTTGGGG + Intergenic
1050977001 9:11951145-11951167 TTTACTTAGACTTGACCAAGTGG + Intergenic
1051079508 9:13278996-13279018 TTTCCTTTTCCTTGACCCAGAGG - Intronic
1057861600 9:98645077-98645099 TTTCCTGAGCCTTGAGAGACTGG + Intronic
1059358292 9:113718473-113718495 GTTCCTTAGCCTTGGAAGAGAGG + Intergenic
1059884160 9:118726989-118727011 TTTCCTTTGCTTTGACCTTGGGG + Intergenic
1203664706 Un_KI270754v1:14513-14535 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1203665276 Un_KI270754v1:17329-17351 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1203666416 Un_KI270754v1:22965-22987 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1203667566 Un_KI270754v1:28604-28626 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1203668712 Un_KI270754v1:34243-34265 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1203669557 Un_KI270754v1:38469-38491 TTTCCTTGGCATTGACGGAAAGG - Intergenic
1188068614 X:25693155-25693177 TTTCTTTATCCTTGACCTTGGGG + Intergenic
1188210811 X:27421017-27421039 TTTCCTTATCCTTGACCTTCAGG - Intergenic
1188437836 X:30182819-30182841 TTTCCTTTGCCTTGTTCAAGTGG + Intergenic
1193270000 X:79517637-79517659 TTTCCTTAGTCTTGCTTGAGAGG + Intergenic
1195312470 X:103644943-103644965 TTTCTTTATCCTTGACCTATGGG - Intergenic
1197852597 X:130879143-130879165 TTTCCCAAACCTTGACCGTGGGG - Intronic