ID: 1093925346

View in Genome Browser
Species Human (GRCh38)
Location 12:24903361-24903383
Sequence GTTTCCTTAGCCTTGACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093925346_1093925349 -3 Left 1093925346 12:24903361-24903383 CCCTCGGTCAAGGCTAAGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1093925349 12:24903381-24903403 AACCTCGGAGAAACTACATTAGG 0: 1
1: 0
2: 1
3: 7
4: 78
1093925346_1093925350 -2 Left 1093925346 12:24903361-24903383 CCCTCGGTCAAGGCTAAGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093925346 Original CRISPR GTTTCCTTAGCCTTGACCGA GGG (reversed) Intronic
900408717 1:2503503-2503525 GTCTCCTTAGCCTGGAGGGAGGG + Intronic
901145134 1:7059679-7059701 GTTTCTTAAGCCTTGTTCGAAGG + Intronic
905258504 1:36700981-36701003 GTTCCCTTTGCCCTGACAGAGGG - Intergenic
916379331 1:164191218-164191240 CTTTCCTTATCCTTGACCTTTGG - Intergenic
918018548 1:180662552-180662574 GTTTCTTTATCCTTGACCTTTGG + Intronic
1081212383 11:40353004-40353026 GTTTCTTTATCCTTGACCTTTGG + Intronic
1086883581 11:92177582-92177604 TTTTCCTGAGCCTTTACTGAGGG + Intergenic
1087417030 11:97870565-97870587 CTTTCCTTATCCTTGACCTTGGG + Intergenic
1089340144 11:117751752-117751774 GTTGCCTTGACCTTGACCAAGGG - Intronic
1092815846 12:12311681-12311703 GTTTTCTTAGCTTTGAGTGAAGG + Intergenic
1093925346 12:24903361-24903383 GTTTCCTTAGCCTTGACCGAGGG - Intronic
1094757691 12:33491179-33491201 CTTTCTTTAGCCTTGACCTTTGG - Intergenic
1099504340 12:83454257-83454279 GTTTCCATGTCCTTGACCTAAGG + Intergenic
1099808392 12:87548547-87548569 CTTTCCTTATCCTTGACCTCTGG - Intergenic
1101162351 12:101992111-101992133 CTTTCCTTATCCTTGACCTATGG + Intronic
1104382864 12:128323264-128323286 GTTTCCTGAGCCTGGACTGATGG + Intronic
1106582001 13:31026874-31026896 GATTCCTTAGCCTTGAGCTGTGG + Intergenic
1108917944 13:55639429-55639451 GTTTCATTAGCTGTGACAGAAGG - Intergenic
1112539132 13:100290001-100290023 GTTTCTTTAGCCCTGAACGGGGG + Intronic
1113146441 13:107213133-107213155 CTTTCCTCAGCATTGCCCGATGG + Intronic
1113496242 13:110731735-110731757 GTTGCCTTAGCCTCTACAGATGG - Intergenic
1117102211 14:52361353-52361375 ATTTCCTTACCCTTTACAGATGG + Intergenic
1120697625 14:87661354-87661376 CTTTCCTTATCCTTGACCTTTGG - Intergenic
1125344526 15:38705606-38705628 GATTCCTCAGCCGTGACTGAGGG - Intergenic
1131323328 15:91419208-91419230 GTTTCTTTATCCTTGACCTTTGG + Intergenic
1132572951 16:651915-651937 GTTTCCATAGCCTTGAGCCCTGG + Exonic
1134367715 16:13594814-13594836 GTTTCCTTCTCCTGGACTGAAGG + Intergenic
1138335859 16:56252337-56252359 CTTTCCCTAGCCTTGTCTGAGGG - Intronic
1145988821 17:29065856-29065878 GTCTCCTCAGCCTTGGCCCATGG + Intergenic
1150959004 17:69893883-69893905 GTTTGCTTAGCACTGACCCAAGG + Intergenic
1164487176 19:28668476-28668498 GTTTCCTTGGCATTTCCCGAGGG - Intergenic
926516460 2:13852425-13852447 TTTTCCTTATCCTTGACCTTTGG - Intergenic
942834327 2:180275932-180275954 GTTTCTTTATCCTTGACCTCTGG + Intergenic
1170890965 20:20374973-20374995 GTTTCCTTAGCAGTGTCAGAAGG - Intergenic
1171938153 20:31295543-31295565 TTTTCTTTAGCCTTGATCTATGG - Intergenic
1179375411 21:40846568-40846590 GTTTCCTTATCATTGACCGGGGG - Intronic
1181596793 22:23920686-23920708 GATTCTGTAGCCTTGACCCAAGG + Intergenic
1182149984 22:28021131-28021153 CTTTTCTTAGCCTTGGCTGAGGG - Intronic
1184005851 22:41708316-41708338 GTATCCTTTGCCTTCAACGAGGG + Intronic
1184136814 22:42554519-42554541 GTTTCCTAAGCCTTTCCCAAAGG - Intronic
1184308491 22:43625558-43625580 GTTTCCTTGGCCTTCTCCCAGGG - Intronic
949928711 3:9061437-9061459 GTTCCCTCAGCCTTGGCCCAAGG + Intronic
951125110 3:18975390-18975412 GTGTCCTTATCCTTGACCTTAGG + Intergenic
953044159 3:39280669-39280691 GTGTCCTCAGCCTTGACTGATGG - Intronic
957338664 3:78864231-78864253 CTTTCCTTTGCCTTGAATGATGG + Intronic
957434352 3:80154497-80154519 ATTTCCTTATCCTTGACCTTTGG + Intergenic
957504806 3:81106076-81106098 GTTTCCTTACCCTAGATGGATGG + Intergenic
961365714 3:126398126-126398148 GTTCCCTAAGCCTTGGCAGAGGG + Intronic
970157710 4:13158272-13158294 GATTCCATATCCTTGACAGATGG + Intergenic
973297714 4:48543994-48544016 GTTTCCTTTGCATTCACAGAAGG - Exonic
974067539 4:57093746-57093768 GTTTGCTTAGACTTGAGCTAAGG - Intronic
980268603 4:130553629-130553651 CTTTCCTTAACCTTGACCTTTGG - Intergenic
980597100 4:134968356-134968378 CTTTCCTTATCCTTGACCTCTGG - Intergenic
981446833 4:144849781-144849803 ATTTCATTAGCCTGGACAGAGGG + Intergenic
983760037 4:171394514-171394536 GTTTCCTTAGCTTTGCCCGCTGG - Intergenic
992242988 5:74790145-74790167 TTTTCCCTAGCCTGCACCGATGG + Intronic
992552467 5:77871913-77871935 GTTTCTGTAACCTTGGCCGAGGG - Intergenic
994226400 5:97255930-97255952 CTTTCTTTAGCCTTGACCTTTGG - Intergenic
1003325915 6:5090659-5090681 CTTTCTTCTGCCTTGACCGAGGG + Intergenic
1005000654 6:21237264-21237286 TTTTCCTTTACCTTGACCCAAGG - Intergenic
1009387938 6:63109921-63109943 CTTTCCTTATCCTTGACATATGG + Intergenic
1009733550 6:67643479-67643501 GTTTCCTTGGCTTTGACTGCTGG + Intergenic
1011019167 6:82791245-82791267 CTTTCTTTATCCTTGACCTATGG - Intergenic
1012711139 6:102606925-102606947 CTTTCCTGAGCCTTGAAGGATGG + Intergenic
1013815237 6:114090050-114090072 GTTTCCTTATCTTTGGCAGAGGG - Intronic
1016136696 6:140553347-140553369 CTTTCTTTATCCTTGACCTATGG + Intergenic
1017304557 6:152901457-152901479 GTTTCCTAAGCCTGGTCAGAAGG - Intergenic
1023309092 7:38865012-38865034 GTTTCCTTTGCATTGTCCAAAGG - Intronic
1028308124 7:89291846-89291868 CTTTCCTTATCCTTGACCTTTGG - Intronic
1030474429 7:110011928-110011950 GTTTTATTATTCTTGACCGAAGG + Intergenic
1033779540 7:144652171-144652193 GTTGCCTTATCCTTCACCTATGG + Intronic
1035222784 7:157416006-157416028 GTTTCCTTAGGATTGAAAGAAGG + Exonic
1043600410 8:81930035-81930057 TTTTCTTTAGCCTTGACCTTTGG - Intergenic
1044241675 8:89894959-89894981 CTTTCCTTATCCTTGACCTTCGG - Intergenic
1186547397 X:10464829-10464851 GTAGCCTTGGCCTTGACTGATGG - Intronic
1188171032 X:26926696-26926718 TTTTCCTTAGCCTTCAGAGAGGG - Intergenic
1192101926 X:68273904-68273926 GTTTCCTGAGACTTCACCAAAGG - Intronic
1192700659 X:73467761-73467783 CTTTCTTTATCCTTGACCTATGG + Intergenic
1195312471 X:103644944-103644966 CTTTCTTTATCCTTGACCTATGG - Intergenic
1196068342 X:111490496-111490518 GTTTCCTGGGCCTTGAGGGAAGG + Intergenic
1196662920 X:118286904-118286926 TTTTCCTGAGGCTTGACTGAGGG + Intergenic
1201438828 Y:13986391-13986413 GTCTCCTTGGCCTTGGCCGGAGG + Exonic
1201445745 Y:14056317-14056339 GTCTCCTTGGCCTTGGCCGGAGG - Exonic