ID: 1093925350

View in Genome Browser
Species Human (GRCh38)
Location 12:24903382-24903404
Sequence ACCTCGGAGAAACTACATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093925342_1093925350 9 Left 1093925342 12:24903350-24903372 CCGGGAAGCGCCCCTCGGTCAAG 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1093925340_1093925350 24 Left 1093925340 12:24903335-24903357 CCTCTAGGTGAATGGCCGGGAAG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1093925346_1093925350 -2 Left 1093925346 12:24903361-24903383 CCCTCGGTCAAGGCTAAGGAAAC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1093925345_1093925350 -1 Left 1093925345 12:24903360-24903382 CCCCTCGGTCAAGGCTAAGGAAA 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1093925347_1093925350 -3 Left 1093925347 12:24903362-24903384 CCTCGGTCAAGGCTAAGGAAACC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093925350 Original CRISPR ACCTCGGAGAAACTACATTA GGG Intronic
904312691 1:29639589-29639611 ACCTCAGAGAATATACATTCTGG + Intergenic
904571290 1:31467742-31467764 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
905154783 1:35967266-35967288 ACCTCAGTGAAGCTACATAAAGG - Intronic
905398606 1:37685143-37685165 ACCTCTTAGAAACTTGATTAAGG - Intronic
905714458 1:40136113-40136135 AACTAGTAGAAACTACATCATGG - Intergenic
911299194 1:96152040-96152062 ACCTAGGAGGAACTCCCTTAAGG + Intergenic
916511258 1:165474089-165474111 ACCTCAGAGATCCTACATGAAGG + Intergenic
920988802 1:210915838-210915860 AGCTCGGATAATCTATATTATGG + Intronic
923290743 1:232543192-232543214 ACCTAGGTGAAAGTACAGTAAGG - Intronic
1069776588 10:70930806-70930828 ACCTCGCAAAAGCTACATGAAGG - Intergenic
1070084361 10:73221610-73221632 ACATGGGGAAAACTACATTAAGG - Intronic
1071283285 10:84122621-84122643 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1072243193 10:93516914-93516936 ACCTATGACAAACAACATTACGG - Exonic
1080322352 11:31026313-31026335 ACATAGCAGAAACTACATAATGG + Intronic
1080381240 11:31774294-31774316 ACCTCAGAGAAAAAAGATTAAGG - Intronic
1084624763 11:70297758-70297780 ACCTCGGAGCACAGACATTACGG - Intronic
1085087931 11:73684609-73684631 ACCTCGGAGATACTGCAGTCTGG - Intronic
1087315252 11:96594893-96594915 TCCACTGAGAAAATACATTATGG + Intergenic
1090323890 11:125868332-125868354 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1093104242 12:15066382-15066404 ACCTGGGACAAAATACATGAGGG - Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1096884816 12:54706639-54706661 GCCTCGGAGAAATAACATAAAGG - Intergenic
1098335078 12:69395850-69395872 AACTCGGATAAATAACATTATGG + Intergenic
1115188544 14:30720900-30720922 ACCATGCATAAACTACATTAAGG - Intronic
1116725704 14:48559179-48559201 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1120546579 14:85819592-85819614 ACCTGGGAGAAAATACATACTGG + Intergenic
1142523579 17:521909-521931 ACCTAGGAGAAACAACATCAAGG + Intronic
1148762577 17:50014594-50014616 CCCTCAGAGAAACTCCACTAGGG - Intergenic
1150237773 17:63606897-63606919 TGCTAGTAGAAACTACATTAAGG - Intronic
1154391748 18:13942608-13942630 ACCTCAGAGAAACTTTGTTAGGG + Intergenic
1154527847 18:15311520-15311542 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
928410563 2:31051015-31051037 ACCTCGGAGAAACCACCTTCAGG + Intronic
936025673 2:109029375-109029397 AAATGGGAGAAACTTCATTAGGG + Intergenic
936716584 2:115193867-115193889 ACCTAGGAGAAACTCCCTTCAGG - Intronic
940143446 2:150521312-150521334 ACCTTGGAGAGACAGCATTAAGG + Intronic
940352585 2:152705805-152705827 ACCTAGGAGAAACTCCCTTCAGG + Intronic
940898915 2:159108482-159108504 ACCTCAGAGAAAATAGATGAGGG + Intronic
941909537 2:170750040-170750062 ACTTGGAAGAAACTACATCAAGG + Intergenic
943824324 2:192369926-192369948 ACATCGGAGAAAATTCATTAAGG + Intergenic
944039497 2:195337848-195337870 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1173882103 20:46423233-46423255 ACCTCAGAGAAACCAGATTGAGG + Intronic
1176769580 21:13057025-13057047 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1176874483 21:14114705-14114727 CCCTCAGAGAAACTAGATTTGGG + Intronic
1179337462 21:40471269-40471291 AACTCTAAGAAACCACATTAGGG + Intronic
1180516681 22:16150969-16150991 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1182311807 22:29414639-29414661 ACCTAGGAGGAACTACCTTCAGG - Intronic
1182688461 22:32138665-32138687 ACCTAGGAGGAACTACCTTCAGG + Intergenic
949610162 3:5696084-5696106 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
952603803 3:35118913-35118935 TTCTAGGAGAATCTACATTAAGG + Intergenic
956357203 3:68407069-68407091 ATCACGGAGAAACTGCATTTAGG - Intronic
956731552 3:72201136-72201158 ACCAGGGAGAAACTAGAGTATGG - Intergenic
960022328 3:112968956-112968978 GCTTAGGAGAAAATACATTAAGG + Intronic
962680884 3:137799191-137799213 ACTTCTGAGAAACTGAATTAAGG + Intergenic
967409225 3:189150695-189150717 GCCTCGGAGAAACTTCACTGAGG - Intronic
967781441 3:193444777-193444799 ACCTGGGAGAAGCTATGTTAAGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
983096738 4:163571309-163571331 ACCTCAGAGAATTTACATTCTGG - Intronic
983702449 4:170614658-170614680 ACCTAAGAGAATCTCCATTAGGG - Intergenic
987881156 5:23748289-23748311 ACCACAAAGAAACAACATTAGGG + Intergenic
988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG + Intergenic
1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG + Intergenic
1003527297 6:6909017-6909039 ACCTCAGAGAAACAAGATTGTGG - Intergenic
1004227192 6:13796819-13796841 ACCTGGGAAAAACTACATCAAGG - Intronic
1005104636 6:22210631-22210653 ACCTAGGAGAAACTACATCTAGG + Intergenic
1014634373 6:123826640-123826662 ACCTTGAAGATATTACATTAAGG - Intronic
1018132644 6:160747413-160747435 ACCTCTGAGAAACTGCAGCAGGG - Intronic
1018191546 6:161313738-161313760 ACCTAGGAGGAACTACCTTCAGG - Intergenic
1023439502 7:40171435-40171457 ACCTAGGAGGAACTCCATTCAGG - Intronic
1028720804 7:94028651-94028673 ACCTGGGAGCTACTAAATTAGGG + Intergenic
1046545372 8:115642897-115642919 ACCTCGGAGATACTACACCTCGG + Intronic
1050760622 9:9065616-9065638 CCATGGGAGAAAATACATTATGG + Intronic
1052538669 9:29778869-29778891 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1053705641 9:40750331-40750353 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1054415718 9:64873938-64873960 ACCTAGGAGAAACTCCCTTCAGG - Intergenic
1185487968 X:497597-497619 GCCTCGGAGAGACTACGGTACGG - Intergenic
1185532224 X:831104-831126 ATCTCGGGGAAACTAACTTAGGG - Intergenic
1188336677 X:28943859-28943881 AACTCAGAAAAAATACATTAAGG - Intronic
1192273067 X:69601805-69601827 ACCTCGAATAACCAACATTAGGG + Intergenic
1192704867 X:73518878-73518900 ACCTCAGAGAGCCTCCATTAGGG - Intergenic
1198489970 X:137129715-137129737 ACCTCGGAGAAAGGACCTGATGG - Intergenic