ID: 1093930065

View in Genome Browser
Species Human (GRCh38)
Location 12:24947156-24947178
Sequence GTGTGTGTGTGGAGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2755
Summary {0: 1, 1: 4, 2: 55, 3: 380, 4: 2315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093930065_1093930069 13 Left 1093930065 12:24947156-24947178 CCGTCTTCCCTCCACACACACAC 0: 1
1: 4
2: 55
3: 380
4: 2315
Right 1093930069 12:24947192-24947214 CACACACACACACACACACACGG 0: 1789
1: 2002
2: 2702
3: 4398
4: 7597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093930065 Original CRISPR GTGTGTGTGTGGAGGGAAGA CGG (reversed) Intronic
Too many off-targets to display for this crispr