ID: 1093930412

View in Genome Browser
Species Human (GRCh38)
Location 12:24949927-24949949
Sequence CTCAAACAGAACTGGGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093930405_1093930412 12 Left 1093930405 12:24949892-24949914 CCCAAGTCTTTGCTGTGGAAGTT 0: 1
1: 0
2: 2
3: 27
4: 237
Right 1093930412 12:24949927-24949949 CTCAAACAGAACTGGGCCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 149
1093930406_1093930412 11 Left 1093930406 12:24949893-24949915 CCAAGTCTTTGCTGTGGAAGTTG 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1093930412 12:24949927-24949949 CTCAAACAGAACTGGGCCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093930412 Original CRISPR CTCAAACAGAACTGGGCCCT TGG Intergenic
901067445 1:6500944-6500966 CTCTACCAGAACTGGGCCTCGGG + Intronic
905534943 1:38713998-38714020 CTCAGACTGAAATGGGGCCTGGG - Intergenic
908089760 1:60673697-60673719 CTCAAACACAAATGGCCCCTAGG - Intergenic
909899810 1:81118898-81118920 CTCCAACAGAAAGGGGCACTAGG - Intergenic
915128841 1:153683427-153683449 CGCAAACTGAACTGGCCCCTGGG + Exonic
915601006 1:156923418-156923440 TTCAAACAGCACTGGACACTAGG + Intronic
918069149 1:181122342-181122364 CAGAAACAGAGCTGGGCCCCGGG + Intergenic
919552542 1:199009870-199009892 CTCAAGCAGAATTAGGCCTTTGG + Intergenic
919838253 1:201591432-201591454 CTCAAAGGCAACTGAGCCCTGGG - Intergenic
922950776 1:229557373-229557395 CTCATTCTGGACTGGGCCCTGGG - Intronic
1062975347 10:1678667-1678689 CCTAAAAAGAACTGGGCCCCTGG - Intronic
1070719925 10:78749292-78749314 CTGTCACAGAACTGGGTCCTTGG + Intergenic
1074051330 10:109883520-109883542 CTGAAACAGGACGGGGTCCTTGG - Intronic
1075405035 10:122189348-122189370 CAGAAACAAAACTGAGCCCTCGG - Intronic
1075639108 10:124051542-124051564 CTCAGACAAGACGGGGCCCTTGG + Intronic
1079082489 11:17423650-17423672 CTCGAACAGAGCTGGGAGCTGGG + Intronic
1081785720 11:45745588-45745610 CTCTGACACCACTGGGCCCTGGG - Intergenic
1083162893 11:60866526-60866548 CTCAAACGCTGCTGGGCCCTAGG + Intergenic
1083269995 11:61567406-61567428 CTGAAACAGAACTCAGTCCTGGG + Intronic
1084493658 11:69491576-69491598 CTGAACCAGCCCTGGGCCCTTGG + Intergenic
1084612090 11:70209673-70209695 CTCAATTAAAACTGGGCGCTAGG + Intergenic
1088707633 11:112478079-112478101 CCCAAGGAGAACTGTGCCCTTGG - Intergenic
1088849173 11:113691043-113691065 CTCAAACAGTCCTGGCTCCTGGG + Intronic
1093930412 12:24949927-24949949 CTCAAACAGAACTGGGCCCTTGG + Intergenic
1094082162 12:26548732-26548754 CTGAGACAGAACTGCTCCCTTGG - Intronic
1095364195 12:41382556-41382578 CTTATACAGAAGAGGGCCCTAGG + Intronic
1096535673 12:52271122-52271144 CTCAAACAGAACATGCCCATGGG - Intronic
1097134311 12:56838909-56838931 CTCAAACAGAAATAGTCCCAGGG + Intergenic
1098046472 12:66406415-66406437 CACTAACAGAACTGGGACCCTGG - Exonic
1098339524 12:69437549-69437571 CACAAACAGACCTGGGCACAGGG - Intergenic
1098563481 12:71904060-71904082 CAAAAAAAGAACTGAGCCCTGGG + Intronic
1100184391 12:92123272-92123294 GTCAACCTGAACTGGGCCATGGG - Intronic
1101939347 12:109088449-109088471 ATGAAAGAGAACTGGCCCCTGGG - Exonic
1102223623 12:111211942-111211964 GACAAACAGAACTGGGACATGGG - Intronic
1109683432 13:65783593-65783615 CTCACACAGACCTGGCACCTGGG - Intergenic
1113842444 13:113367889-113367911 CTTAACCAGAACTGGTCACTGGG - Intergenic
1113842457 13:113367937-113367959 CTTAACCAGAACTGGTCACTGGG - Intergenic
1116167773 14:41355242-41355264 CTCAGAAAGTACTGGGCCCTTGG + Intergenic
1117253810 14:53958163-53958185 CTTAAACAGATATTGGCCCTGGG + Intronic
1119898696 14:78242476-78242498 CTCAGACAGAGCAGGGCCCTGGG - Intronic
1122061813 14:99141027-99141049 CTCCAAGAGAACTGAGCCCCTGG + Intergenic
1125538585 15:40456997-40457019 CTCACTCAGAACTGGGGCCCAGG + Intronic
1125614147 15:40994792-40994814 CTAAAACAACGCTGGGCCCTTGG + Intronic
1127098250 15:55535250-55535272 CTCAATCAGGCCTGGGCCCCAGG - Intergenic
1130854471 15:87829413-87829435 CTCAAACATCGCTGGCCCCTAGG - Intergenic
1133557305 16:6917809-6917831 CTCTTAGAGAACAGGGCCCTGGG + Intronic
1134508126 16:14824435-14824457 CTTAAATAGAGCTGGGCTCTCGG + Intronic
1134695824 16:16223200-16223222 CTTAAATAGAGCTGGGCTCTCGG + Intronic
1134976003 16:18571488-18571510 CTTAAATAGAGCTGGGCTCTCGG - Intergenic
1137624715 16:49900309-49900331 CTCAAAGAGAATTAGACCCTGGG + Intergenic
1138898948 16:61244883-61244905 CGCAAACAGAAATGGGTGCTCGG - Intergenic
1139681809 16:68570895-68570917 CTTTCACAGAACTGAGCCCTGGG - Intronic
1141512357 16:84520809-84520831 CTCTTACAGAATTGTGCCCTTGG - Intronic
1141599657 16:85117837-85117859 CTTAAACTGTGCTGGGCCCTGGG + Intergenic
1143520345 17:7440871-7440893 CTCAGGGAGAACTGGGCCCCCGG + Intronic
1145007875 17:19347754-19347776 CTCATTCTGACCTGGGCCCTGGG - Intronic
1145029785 17:19495664-19495686 CCCAAACAGACCTGGGCGCGAGG - Intronic
1147667848 17:42160011-42160033 CCCAGACAGGCCTGGGCCCTGGG + Exonic
1148822621 17:50368373-50368395 CTCACACAGAGCCGGGCCCTGGG + Intronic
1151803971 17:76394084-76394106 CTCAAGCAGCACTGGGCCTTAGG + Intronic
1151849275 17:76680702-76680724 CTCAATCAGGACTTGTCCCTTGG - Intronic
1152060871 17:78074269-78074291 CTCAACCTGAACTGGGAACTTGG + Intronic
1155148895 18:23106681-23106703 CTCTAACACAACTGGGTCCCTGG + Intergenic
1156943870 18:42802976-42802998 CTCTACCAGAACCTGGCCCTGGG + Intronic
1157743602 18:50115298-50115320 CTCAGACAGCAGTGAGCCCTTGG + Intronic
1157832271 18:50867440-50867462 CTCAAACATGACTGTGCCCTGGG + Intergenic
1162155612 19:8676411-8676433 CTCCAATTGAACTGAGCCCTGGG + Intergenic
1162473251 19:10885048-10885070 ATCAAACAGAACTAAGGCCTGGG - Intronic
1162921334 19:13905148-13905170 CTGAAAGACAAATGGGCCCTGGG + Intronic
1164146991 19:22518290-22518312 CTCTGGCAGAACTGGGCCCTGGG + Intronic
1165009566 19:32834156-32834178 CTCACACTGTCCTGGGCCCTGGG + Intronic
1166801885 19:45462900-45462922 CCCAAGCAGAGCTGAGCCCTTGG + Intronic
1166882770 19:45939572-45939594 ATCACACAGACCTGGGCCCTGGG + Exonic
1168325454 19:55536577-55536599 AGCAAACAGACTTGGGCCCTGGG + Intronic
928377755 2:30789892-30789914 GTCAGTCAGACCTGGGCCCTGGG + Intronic
928949759 2:36804307-36804329 CCCAACCAGACCTGTGCCCTTGG + Intronic
930025352 2:47026074-47026096 CTCCAAGGAAACTGGGCCCTAGG - Intronic
932497560 2:72153881-72153903 CTGAAACAGAGCTGGGTTCTGGG + Intergenic
937275318 2:120680305-120680327 CTCCAACACACCTGGGCTCTTGG + Intergenic
939428122 2:142067285-142067307 CTCAAAGATATCTGGGTCCTAGG - Intronic
940916473 2:159261976-159261998 CTTAAGCAGAACTGGGCTCTAGG - Intronic
941104780 2:161340649-161340671 CTCAATCAGGACTTGTCCCTTGG - Intronic
946413555 2:219527609-219527631 TTCAAACAGAACTGAACCCCAGG - Intronic
948469728 2:238169298-238169320 CTCAAACTGAAATGGGTACTTGG + Intergenic
948781459 2:240324230-240324252 CTCAAACAGCAGTGGGGCCCGGG + Intergenic
949037897 2:241826667-241826689 AACAAACAAAACTGAGCCCTGGG + Intergenic
1175435672 20:58945848-58945870 CCCAAAGAGAAATGTGCCCTGGG + Intergenic
1177628149 21:23691513-23691535 CTCAACCACCACTGTGCCCTTGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178964402 21:37102638-37102660 GTCAGACAGAACTGGGCTCTTGG + Intronic
1180100893 21:45584905-45584927 CTGATACAGAAATGGGCCCTGGG + Intergenic
1181888092 22:26037597-26037619 CTAACACAGCACTGAGCCCTAGG + Intergenic
1182472948 22:30559890-30559912 CTCACACTGCACTGCGCCCTGGG + Intronic
1182900518 22:33894578-33894600 TTCAAACAAAACTGGGACATGGG + Intronic
952698326 3:36296952-36296974 CATAAATAGAACTGTGCCCTTGG + Intergenic
953097976 3:39797720-39797742 ATCAAACAGAGCTGTGACCTTGG - Intergenic
954691541 3:52398102-52398124 CTCATACAGCACTGGGTACTTGG - Exonic
956910001 3:73807493-73807515 TACACACAGCACTGGGCCCTGGG - Intergenic
957780051 3:84807308-84807330 CTGAATCAGAACTGGGCTTTGGG + Intergenic
957929913 3:86864138-86864160 CTGAAGCAGAAGTGGCCCCTAGG + Intergenic
959651904 3:108758285-108758307 CTGAAACATACCTGGGCCCCAGG - Intergenic
961822380 3:129581767-129581789 CTTAGTCAGTACTGGGCCCTGGG - Intronic
961860453 3:129913046-129913068 CTCAGAGACAAGTGGGCCCTTGG + Intergenic
962929210 3:140021954-140021976 GGCAGACAGAACTGGGACCTGGG + Intronic
963503374 3:146156627-146156649 CTGAAGGAAAACTGGGCCCTAGG - Intronic
967537311 3:190621582-190621604 CACAGACAGATCTGGGCACTGGG + Intronic
968922239 4:3528356-3528378 CCCAAGCAGTGCTGGGCCCTTGG - Intronic
974327177 4:60429103-60429125 CTCAAACATAACTTGCCCGTGGG - Intergenic
976454415 4:85229181-85229203 CTCCAACAGAGCTTGGCCATAGG - Intergenic
977956257 4:103030334-103030356 CTCAAACAGCACTGGGAAATAGG + Intronic
980102344 4:128554293-128554315 CTCAAACAGGTTTGGGCTCTAGG - Intergenic
980235609 4:130101281-130101303 CACAAACTGAACTGGGCTCAAGG - Intergenic
985078404 4:186241365-186241387 CTGAACCAGAACTCGACCCTTGG + Intronic
986789830 5:11148804-11148826 CTCAAACAGGAATGCTCCCTGGG + Intronic
986955184 5:13141966-13141988 ATAAAAGAGAACTGGGCCCTAGG - Intergenic
987144698 5:14980940-14980962 CACAATCAGAACTGAGCCTTAGG - Intergenic
991486572 5:67143452-67143474 CTGAGACAGAACAAGGCCCTAGG + Intronic
992019223 5:72605880-72605902 CTTGGACAGAACTGGGCTCTGGG + Intergenic
992137660 5:73763564-73763586 CCCAAACAGAACAGGGTCCCTGG + Intronic
998043737 5:138969994-138970016 CTGCAACAGTACTGTGCCCTGGG + Intronic
999276928 5:150337744-150337766 CACAAGCAGCACTGGGGCCTAGG + Intronic
999868347 5:155726504-155726526 CTGAAACAGATCTGGTCCCTTGG - Intergenic
1000397052 5:160787010-160787032 CTGAGAATGAACTGGGCCCTAGG - Intronic
1002451096 5:179318879-179318901 CACAAAGAGAGCTGGTCCCTGGG + Intronic
1002621159 5:180489481-180489503 CTCAAACATGACTGGGGCATTGG - Intergenic
1002931577 6:1638558-1638580 CTCAGGCAGGACTGGGCTCTGGG + Intronic
1004969769 6:20896844-20896866 CTCAAAGAGAGCTGTGACCTTGG + Intronic
1007450390 6:41937503-41937525 CAGAAACAGAACTGGGGTCTTGG - Intronic
1010033528 6:71294345-71294367 CTCACACAGAAAAGGGCTCTTGG - Intronic
1010152338 6:72748319-72748341 CTGTCACAGAACTGTGCCCTGGG + Intronic
1010204049 6:73307570-73307592 CACAAACAGAACTGGGGTCTTGG + Intronic
1011854598 6:91673645-91673667 CACAAGCAGAACTGGGGCTTCGG + Intergenic
1013155456 6:107488996-107489018 CTCAATCAGACCTCGGCCCCAGG + Intergenic
1015689838 6:135909797-135909819 CTCCACCAGCACTGGGCTCTGGG - Intronic
1016486246 6:144542833-144542855 GTGAAACAGAACTGGGCTCCTGG - Exonic
1017832389 6:158142420-158142442 CTCACAAAGCACTGGGCACTGGG + Intronic
1018974873 6:168556549-168556571 CTCAAACAGCCCTGGGCTTTTGG - Intronic
1019733324 7:2638966-2638988 CCCAAACAAGTCTGGGCCCTAGG + Intronic
1022184992 7:27958657-27958679 GTCACACAGAACTGGACCCCTGG - Intronic
1022903155 7:34830071-34830093 CTCAAACAAGACCAGGCCCTGGG + Intronic
1023537271 7:41226572-41226594 GTGAAAGAGAACTGTGCCCTTGG + Intergenic
1023683000 7:42706874-42706896 CTCCAACAGACTTGCGCCCTCGG - Intergenic
1024569185 7:50709986-50710008 CTCTCACAGCACTCGGCCCTGGG + Intronic
1028464785 7:91138828-91138850 CAAAAATAAAACTGGGCCCTGGG + Intronic
1034190153 7:149207594-149207616 CTCTGGCAGAACTGGCCCCTGGG - Intronic
1034312095 7:150097757-150097779 CTCAAGCAGAGCTGGGCCACAGG + Intergenic
1034794761 7:154002901-154002923 CTCAAGCAGAGCTGGGCCACGGG - Intronic
1036200899 8:6771074-6771096 CAAAAGCAGAACTGGGTCCTAGG + Intergenic
1036213670 8:6862714-6862736 GTCAGACAGACCTGGGCCTTTGG - Intergenic
1040806370 8:51401451-51401473 CTCAAACATAGCTGGGCCTCTGG - Intronic
1042130917 8:65586205-65586227 ATCAAAAAGCACTGGGCTCTTGG + Intergenic
1042831676 8:73036144-73036166 CTCAAAAAGCACTGGGCCCTTGG - Intronic
1045254326 8:100506966-100506988 CTCAGACAGACCTGGGCCTCTGG + Intergenic
1050127824 9:2377664-2377686 CTCACAAAGTACTGGGCCTTGGG + Intergenic
1050128172 9:2381131-2381153 ATCCAACAGACCTGGGCTCTGGG - Intergenic
1050182059 9:2933351-2933373 CCAAGACAGAACTGGGCCCAGGG + Intergenic
1050650288 9:7768476-7768498 ATGAAACAGAACAGAGCCCTCGG - Intergenic
1053032003 9:34788381-34788403 CTCAAACAAAATTGGGCACGAGG + Intergenic
1053415820 9:37946212-37946234 ACCAAACACAGCTGGGCCCTTGG + Intronic
1059356783 9:113706024-113706046 CTGCAACAGAAATGGGCCCAAGG - Intergenic
1059440038 9:114301589-114301611 CTCAAGCAGACCTGGGACCCAGG - Intronic
1059671360 9:116495496-116495518 CTCAGACACAACTGGGTCCAGGG - Intronic
1060590070 9:124810940-124810962 CTCAGCCAGAACAGGGCCCTAGG - Exonic
1188294818 X:28434462-28434484 CTCATTCATTACTGGGCCCTGGG - Intergenic
1191039940 X:56068327-56068349 CTCAAACAGAAGTGGGCTGTCGG - Intergenic
1191980422 X:66918596-66918618 CTGAAACATCACTGGGCACTTGG + Intergenic
1193716583 X:84941371-84941393 GTGAAACAGATCTGGGCCCAGGG + Intergenic
1196426969 X:115579950-115579972 CTCAAGCAGTACTCCGCCCTTGG + Intronic
1197922881 X:131613987-131614009 GTTAAACAGAACAGGGCCCTGGG - Intergenic
1198763661 X:140059764-140059786 CACACCCAGAACTGGGCCCTAGG - Intergenic