ID: 1093931140

View in Genome Browser
Species Human (GRCh38)
Location 12:24956099-24956121
Sequence TAATCCCAGCTCCCCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093931140_1093931152 28 Left 1093931140 12:24956099-24956121 CCCGCCCCGGGGAGCTGGGATTA No data
Right 1093931152 12:24956150-24956172 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
1093931140_1093931151 27 Left 1093931140 12:24956099-24956121 CCCGCCCCGGGGAGCTGGGATTA No data
Right 1093931151 12:24956149-24956171 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1093931140_1093931153 29 Left 1093931140 12:24956099-24956121 CCCGCCCCGGGGAGCTGGGATTA No data
Right 1093931153 12:24956151-24956173 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093931140 Original CRISPR TAATCCCAGCTCCCCGGGGC GGG (reversed) Intergenic
No off target data available for this crispr