ID: 1093931626

View in Genome Browser
Species Human (GRCh38)
Location 12:24960329-24960351
Sequence AGGAAGAGCACAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093931620_1093931626 14 Left 1093931620 12:24960292-24960314 CCATATGGCATGGAGAGAGATTC No data
Right 1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG No data
1093931618_1093931626 26 Left 1093931618 12:24960280-24960302 CCTTGTCAGAGGCCATATGGCAT No data
Right 1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG No data
1093931617_1093931626 27 Left 1093931617 12:24960279-24960301 CCCTTGTCAGAGGCCATATGGCA No data
Right 1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093931626 Original CRISPR AGGAAGAGCACAGTGACTGT GGG Intergenic
No off target data available for this crispr