ID: 1093932402

View in Genome Browser
Species Human (GRCh38)
Location 12:24967278-24967300
Sequence TCCCATGACCATGATGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093932400_1093932402 -5 Left 1093932400 12:24967260-24967282 CCTGCAGACGGGACAGCTTCCCA 0: 1
1: 1
2: 3
3: 12
4: 124
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932391_1093932402 12 Left 1093932391 12:24967243-24967265 CCTCCAGCACCCCCGACCCTGCA 0: 1
1: 0
2: 3
3: 55
4: 567
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932399_1093932402 -4 Left 1093932399 12:24967259-24967281 CCCTGCAGACGGGACAGCTTCCC 0: 1
1: 1
2: 2
3: 17
4: 134
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932396_1093932402 2 Left 1093932396 12:24967253-24967275 CCCCGACCCTGCAGACGGGACAG No data
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932398_1093932402 0 Left 1093932398 12:24967255-24967277 CCGACCCTGCAGACGGGACAGCT 0: 1
1: 1
2: 0
3: 8
4: 152
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932397_1093932402 1 Left 1093932397 12:24967254-24967276 CCCGACCCTGCAGACGGGACAGC No data
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932392_1093932402 9 Left 1093932392 12:24967246-24967268 CCAGCACCCCCGACCCTGCAGAC 0: 1
1: 0
2: 3
3: 47
4: 390
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932390_1093932402 30 Left 1093932390 12:24967225-24967247 CCAGGGAGCTGAAGCAGTCCTCC 0: 1
1: 0
2: 3
3: 56
4: 490
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158
1093932395_1093932402 3 Left 1093932395 12:24967252-24967274 CCCCCGACCCTGCAGACGGGACA No data
Right 1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093932402 Original CRISPR TCCCATGACCATGATGGAGT TGG Intergenic
900083128 1:873971-873993 TCGCATGCCCATGAGGGAGGTGG + Intergenic
900127073 1:1073424-1073446 TCACCTGACCATGAGGCAGTGGG - Intronic
902993939 1:20209409-20209431 TCTCATGATCATGATGGACGAGG - Intergenic
903686281 1:25134756-25134778 TCCCAAGTCCCTAATGGAGTGGG + Intergenic
906703975 1:47881147-47881169 TCCCATGCCCATGATCAACTTGG + Intronic
908971364 1:69837190-69837212 TCCCATGACAATGCTGGGGTTGG - Intronic
909263049 1:73519671-73519693 TCACATTTCCATGATGGATTTGG + Intergenic
911634018 1:100213498-100213520 TCCCACGACCACGATAGAGTTGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
912726125 1:112060182-112060204 CCCGATGGCCATGAGGGAGTGGG + Intergenic
915272851 1:154767460-154767482 TCCCATAACATTGATGAAGTGGG - Intronic
916475841 1:165168267-165168289 CTCCATGACCATGGTGGATTTGG + Intergenic
916638771 1:166703336-166703358 TCACATGACCAGGATAGATTAGG - Intergenic
916940557 1:169672550-169672572 TCCCAGCACCATTATGGAATAGG - Intronic
917210090 1:172622266-172622288 TCACATGACCATGAGAGATTAGG - Intergenic
919983472 1:202657173-202657195 TGTCATGACCATGATGAGGTTGG - Intronic
924243311 1:242059909-242059931 TCACATGTCCATGAAGGAGGTGG + Intergenic
1062763930 10:47413-47435 TCGCATGCCCATGAGGGAGGTGG - Exonic
1063210790 10:3879353-3879375 TCCCAGGATCATGACGGAGTCGG + Intergenic
1068878425 10:62022612-62022634 TCACATGACCAGGAAGGACTAGG - Intronic
1069946633 10:71990869-71990891 TCCCATGAACATTATGTATTAGG + Intronic
1071137731 10:82471095-82471117 TCACATGACCATGAAAGATTAGG + Intronic
1071526808 10:86363972-86363994 CTCGATGACCTTGATGGAGTAGG + Exonic
1073791167 10:106941916-106941938 TCCCATAACCAGGATGGAGAAGG + Intronic
1073833582 10:107415303-107415325 TCACATGACCATGAAAGATTAGG + Intergenic
1074939795 10:118223393-118223415 TCACATGGACATGATGGGGTTGG - Intergenic
1076030543 10:127154016-127154038 TTCCATGACCATGATGAGCTTGG - Intronic
1080117681 11:28638985-28639007 ACCCAGGACCATGGTGGGGTTGG - Intergenic
1082255095 11:50025534-50025556 TCCCAGCACCATGATTGAATAGG + Intergenic
1083487747 11:62994184-62994206 TTCCAAGGTCATGATGGAGTAGG + Intronic
1083493255 11:63028442-63028464 TCCTATGACCGTGAGGCAGTGGG - Intergenic
1086937884 11:92764323-92764345 TCCCAGGAGCAAGATAGAGTGGG - Intronic
1087606406 11:100383678-100383700 TCCCAAAACCCTGGTGGAGTGGG - Intergenic
1093705774 12:22273529-22273551 TCTCATGACCAGGAAGAAGTAGG - Intronic
1093932402 12:24967278-24967300 TCCCATGACCATGATGGAGTTGG + Intergenic
1098038385 12:66329674-66329696 TGCCATGAGGATGATGGATTGGG + Intronic
1100732343 12:97486063-97486085 TAGCAAGACCATGATAGAGTAGG + Intergenic
1103269931 12:119664861-119664883 TGCCATGACCATGATGTAGTGGG + Intergenic
1103354941 12:120312716-120312738 TCCCACCACCAAGAGGGAGTCGG - Exonic
1103681726 12:122699627-122699649 TGTCATGACTATGGTGGAGTGGG - Intergenic
1103683478 12:122713091-122713113 TGTCATGACTATGGTGGAGTGGG - Intergenic
1103722443 12:122981997-122982019 GCCCATGACCAAGGAGGAGTGGG + Exonic
1104109410 12:125690617-125690639 GCCCCTGGCCATGATGGGGTTGG + Intergenic
1104479121 12:129091788-129091810 TCTCCAGACCAGGATGGAGTTGG - Intronic
1108537660 13:51402437-51402459 TCCCATAACCATGATATTGTGGG + Intronic
1108871141 13:54987972-54987994 TCACATGACCAGGAAAGAGTAGG + Intergenic
1110813672 13:79838720-79838742 TCCCATCACCAAGGTGGATTAGG - Intergenic
1112688569 13:101862161-101862183 TTCCAGGAACATGGTGGAGTAGG + Intronic
1116946092 14:50836631-50836653 TCCTTTAACCATAATGGAGTTGG - Intergenic
1116970433 14:51059115-51059137 TCCCAGGACCATTGTGGAGGTGG - Intronic
1120245179 14:81997970-81997992 TCCCACTACCATGGTGGAGTGGG - Intergenic
1122394312 14:101411955-101411977 GCACATGACCTTGATGGAGCTGG + Intergenic
1127362982 15:58261253-58261275 GCCCATGACCTGGATGGATTAGG + Intronic
1127372237 15:58352351-58352373 TCCCATCACCATCTTGGTGTTGG + Intronic
1131220848 15:90582858-90582880 TTCCCTGACCCTGATGGAGCAGG - Intronic
1133340242 16:5031240-5031262 TACCATGACCATTTTAGAGTGGG - Intronic
1133553148 16:6878470-6878492 TCACATGTCCATCATGGATTTGG - Intronic
1133769509 16:8859570-8859592 CCCCATGACCAGGATGGCATCGG + Intronic
1135016753 16:18930022-18930044 TCCCATGACTGAAATGGAGTAGG - Intergenic
1135077568 16:19407361-19407383 TCCCAGCCCCATGAGGGAGTGGG + Intergenic
1135322387 16:21505875-21505897 TCCCATGACTGAAATGGAGTAGG - Intergenic
1136333865 16:29599005-29599027 TCCCATGACTGAAATGGAGTAGG - Intergenic
1136544588 16:30948258-30948280 TTCCATGACGATGAAAGAGTGGG - Exonic
1137548121 16:49418122-49418144 CCCCATGCCCAAGAGGGAGTGGG - Intergenic
1137684730 16:50378849-50378871 GCCTATGACCATGAAGGGGTGGG + Intergenic
1137815925 16:51397474-51397496 TCCCATGACCATGAAAAATTAGG + Intergenic
1139540642 16:67613334-67613356 TCAGATGACCATGATCAAGTGGG + Intronic
1139980299 16:70852729-70852751 TCCCTTGACAATGATGGAAGAGG + Intronic
1140588396 16:76321981-76322003 TCCCATGACCAGGCTGGGGCAGG + Intronic
1141500899 16:84443435-84443457 TCCCTTGACCTTGATGGAGAGGG - Intronic
1142440718 16:90095814-90095836 TCGCATGCCCATGAGGGAGGTGG + Intergenic
1144064466 17:11612204-11612226 TCACATGACCACCCTGGAGTTGG - Intronic
1144495927 17:15744771-15744793 TCCCATGACTATGCTGTGGTTGG - Intronic
1144631979 17:16878450-16878472 TCCCATGACTGTGCTGTAGTTGG + Intergenic
1145278170 17:21448445-21448467 TCCCATGGCCATAACGGAGCTGG - Intergenic
1145278880 17:21454260-21454282 CCCCACCACCATGATGGACTCGG - Intergenic
1145824977 17:27870034-27870056 TCTCATGACCAGGAAGAAGTAGG - Intronic
1147773645 17:42885061-42885083 TCCCATCACCATGATGTGGTGGG - Intergenic
1149185765 17:53995753-53995775 TCCCTTGACCTTGATGGCATGGG + Intergenic
1150595770 17:66603034-66603056 TCACATGACCATGAAAGATTAGG - Intronic
1150965711 17:69965712-69965734 TCCCATGACCTTCAGGAAGTGGG + Intergenic
1152294205 17:79457174-79457196 GCCCATGTCCAGCATGGAGTAGG + Intronic
1152584027 17:81181214-81181236 ACCCAGGACCAGGATGGAGGAGG + Intergenic
1152956838 18:47746-47768 TCGCATGCCCATGAGGGAGGTGG - Exonic
1153927517 18:9847086-9847108 CCCACTGACCATGATGGAGAAGG - Intronic
1154204531 18:12325746-12325768 GCCCATGTCCATGAAGGAGGTGG + Exonic
1155754077 18:29468217-29468239 TGCCATGACATTGATGGAGCCGG - Intergenic
1156347265 18:36269142-36269164 TCCCATGTACATGATGGTGTGGG + Exonic
1156582907 18:38398426-38398448 TCCTTTGTCTATGATGGAGTGGG - Intergenic
1156998754 18:43498996-43499018 TCCCATCATCATGAAGGAGCTGG + Intergenic
1157033036 18:43936946-43936968 TCCCATGACCAAGATGTGCTCGG + Intergenic
1160128714 18:76204889-76204911 TCCTATGGCCATGATGGCGATGG - Intergenic
1163979236 19:20883079-20883101 TCCCATGATGATGAGTGAGTGGG - Intergenic
1165901714 19:39172441-39172463 TCCCATGAACAACAAGGAGTGGG - Intronic
930025205 2:47025381-47025403 TCCCCTGACCCTTTTGGAGTTGG + Intronic
935757852 2:106290764-106290786 TGCCATGACCGTGCTGCAGTTGG + Intergenic
936034229 2:109097932-109097954 TCCCTTGACCAGGCTGCAGTAGG + Intergenic
939379250 2:141413498-141413520 TCCCAGGATTATGATGGTGTTGG - Intronic
945046798 2:205789015-205789037 TCTCATGAACATGAAGAAGTGGG - Intronic
946759543 2:222979608-222979630 TCTCATGAGCATGAGGCAGTGGG + Intergenic
1173745441 20:45433264-45433286 TCTACTGATCATGATGGAGTCGG - Intergenic
1176972304 21:15280945-15280967 TCACATGACCATGAAAGATTAGG + Intergenic
1177425852 21:20922112-20922134 ACCCATGACCCTGGTGGTGTAGG - Intergenic
1184291215 22:43499024-43499046 TCCCATGGTCATGGTGGAGGTGG + Intronic
949298342 3:2553248-2553270 TCCCATGAGAATGGTGGACTGGG + Intronic
949771947 3:7588565-7588587 TCTCATGTACATGATGGTGTTGG + Intronic
950007702 3:9702086-9702108 TGCCATGTTCATGATGGAGATGG - Exonic
950583018 3:13875056-13875078 TCCTATGACGATGATGGCGTCGG + Exonic
951845391 3:27079383-27079405 TCACATGACCATGAAAGATTAGG + Intergenic
951846960 3:27095007-27095029 TCCCATGACCACAATGGAACAGG - Intergenic
958759714 3:98292375-98292397 ACCCAAGACCCTGGTGGAGTGGG + Intergenic
959660575 3:108863732-108863754 TCACATGACCAGGAAGGATTAGG + Intergenic
961005772 3:123404463-123404485 GCCCCTGACCATGGTGGAGTGGG - Intronic
967582336 3:191173800-191173822 TTCCTTTACCAAGATGGAGTAGG - Intergenic
968357475 3:198120401-198120423 TCGCATGCCCATGAGGGAGGTGG + Intergenic
968404264 4:326593-326615 ACCCAAGACCCTGGTGGAGTGGG - Intergenic
973017578 4:45160365-45160387 TTCCATGACCCTGTTGGAGCAGG + Intergenic
975703958 4:77093300-77093322 TCCCAGGGCCATGATGCAATGGG - Intergenic
981125789 4:141104870-141104892 CCTCATCACCATGAGGGAGTTGG - Intronic
983178468 4:164618923-164618945 GCCCATGACCAGGAAGGAGCTGG + Intergenic
985441064 4:189982849-189982871 TCGCATGCCCATGAGGGAGGTGG - Intergenic
985892182 5:2724551-2724573 TCCCATTAACATGAAGGTGTGGG - Intergenic
990810360 5:59715716-59715738 TCCTATGACCAGGATGGAAACGG + Intronic
992364231 5:76075436-76075458 TCACATGACCTTTAGGGAGTGGG - Intergenic
993419575 5:87684034-87684056 TGCCAGGACCCTGATGAAGTTGG - Intergenic
995744698 5:115391557-115391579 TCCCATCACCAGGGTGGAGGAGG - Intergenic
997587650 5:135053152-135053174 TCTCATGACCATGAAGCTGTGGG - Intronic
998063082 5:139134434-139134456 TTCCATTCCAATGATGGAGTGGG - Intronic
999175293 5:149627706-149627728 GGCCATGACCAGTATGGAGTGGG - Intronic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
999938535 5:156515670-156515692 TCCCAAGACCCTGGTGGCGTGGG - Intronic
1000022747 5:157332940-157332962 TCCCATGACCATGAAAAATTAGG + Intronic
1002417941 5:179130492-179130514 GCACATGACCCTGCTGGAGTAGG + Intronic
1002766686 6:246554-246576 TCCCATGTCCATCATGGTGAAGG + Intergenic
1003673033 6:8177472-8177494 GCACAGCACCATGATGGAGTGGG - Intergenic
1007496192 6:42261564-42261586 TCCCCTGACCTTGATAGGGTTGG - Intronic
1011669385 6:89668072-89668094 TTCCATGACTATGAGGGAGGTGG - Exonic
1013439026 6:110142577-110142599 TCCCATGAAAAAGATGGTGTTGG - Intronic
1013688631 6:112614499-112614521 TCCGATGGCCATGATAGAGTGGG + Intergenic
1014563394 6:122918056-122918078 TCCCAGGAGCAGTATGGAGTAGG - Intergenic
1015681438 6:135813171-135813193 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1015811032 6:137162384-137162406 GCCCAGGACCACTATGGAGTGGG - Intronic
1017522294 6:155213193-155213215 TCCCATGACCAGGAAGAAGGAGG + Intronic
1018300463 6:162396993-162397015 TCCCATGGCCATAGTGGTGTTGG + Intronic
1018578295 6:165283356-165283378 ACCCAAGACCCTGATGGTGTGGG - Intronic
1024560951 7:50644799-50644821 CCCCATGACCAAGAAGGTGTGGG + Intronic
1025157408 7:56620782-56620804 TCACATGACCATGAACGAATAGG - Intergenic
1025628222 7:63243282-63243304 TTCCATGATCATCATGGAGAGGG - Intergenic
1026407580 7:70083300-70083322 TTCCATGATCATGGTGGAGGCGG + Intronic
1028476371 7:91257988-91258010 TCCCAGGCCCCTGGTGGAGTAGG + Intergenic
1028990594 7:97045080-97045102 TATCATGGCAATGATGGAGTTGG - Intergenic
1029123412 7:98282414-98282436 TCCTACGACCACGATAGAGTTGG - Exonic
1035341525 7:158165727-158165749 TCCCAAGACCATCCTGCAGTGGG - Intronic
1036149372 8:6283647-6283669 TCTCCTGACCATGGTGGGGTGGG - Intergenic
1036712702 8:11091792-11091814 TCCCATGGGCAGGATGGATTTGG - Intronic
1043036717 8:75208451-75208473 ACCCAGGACCCTGATGGTGTAGG + Intergenic
1043680954 8:83023774-83023796 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1046152401 8:110244749-110244771 TCCCATGACCAAGAAGAAGAAGG - Intergenic
1046363119 8:113187226-113187248 TCACATGACCAAGAAGGATTAGG - Intronic
1049264872 8:141662528-141662550 TCCCAGGAACATGAGAGAGTCGG + Intergenic
1050805872 9:9677360-9677382 TCCCAGCACCATGATCAAGTGGG + Intronic
1050929856 9:11308991-11309013 TCACATGACCAGGAAGGATTAGG - Intergenic
1052509034 9:29390760-29390782 TCACATGACCAGGAAGGATTAGG + Intergenic
1057097837 9:92328076-92328098 CCCCTTGACCAAGAGGGAGTCGG + Intronic
1057141179 9:92727649-92727671 CCCCATCACCAAGATGGAGGTGG - Intronic
1061217534 9:129230367-129230389 CACCAAAACCATGATGGAGTGGG - Intergenic
1062741327 9:138176886-138176908 TCGCATGCCCATGAGGGAGGTGG + Intergenic
1187034901 X:15528244-15528266 TCCCATGACACTGATAGAATAGG - Intronic
1191645052 X:63471051-63471073 TCACATGACCATGAGAGATTAGG + Intergenic
1196170608 X:112584239-112584261 TCACATCACCATGATATAGTGGG + Intergenic
1199829821 X:151538399-151538421 TCACATGACCAGGAAGGATTGGG + Intergenic