ID: 1093933477

View in Genome Browser
Species Human (GRCh38)
Location 12:24977333-24977355
Sequence TAAGGAAGAAAGGAAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093933474_1093933477 -9 Left 1093933474 12:24977319-24977341 CCATGCTCTGCCACTAAGGAAGA No data
Right 1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG No data
1093933473_1093933477 -6 Left 1093933473 12:24977316-24977338 CCACCATGCTCTGCCACTAAGGA No data
Right 1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG No data
1093933471_1093933477 20 Left 1093933471 12:24977290-24977312 CCAGGCATTGCAAGTCAGGACTT No data
Right 1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093933477 Original CRISPR TAAGGAAGAAAGGAAGTTGC AGG Intergenic
No off target data available for this crispr