ID: 1093937557

View in Genome Browser
Species Human (GRCh38)
Location 12:25017789-25017811
Sequence TTGGAGTGGTGAAAATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 3, 2: 15, 3: 109, 4: 672}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093937557_1093937560 3 Left 1093937557 12:25017789-25017811 CCAGGATATTTTCACCACTCCAA 0: 1
1: 3
2: 15
3: 109
4: 672
Right 1093937560 12:25017815-25017837 GAAACTCCATACTTACCAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093937557 Original CRISPR TTGGAGTGGTGAAAATATCC TGG (reversed) Intergenic
901098952 1:6704321-6704343 TTTGAGTGGTGATAAAAACCAGG - Intergenic
901519208 1:9769655-9769677 TTGGGGTGATGAAAATGTTCTGG + Intronic
902946132 1:19840902-19840924 TTGGGGTGATGGAAATATTCTGG + Intergenic
902952939 1:19901622-19901644 TTGGGGTGATGAAAATATTTTGG - Intronic
903157561 1:21457916-21457938 TTGGTCTGGTGATAATTTCCAGG - Intronic
903991704 1:27275842-27275864 TTGGGGTGATGAAAACATCCTGG - Intronic
904062649 1:27723928-27723950 TTGGAGTGATGAAAATGTTTTGG - Intergenic
904217717 1:28936503-28936525 TTGGAGTAATGAAAATGTTCTGG - Intronic
904656006 1:32047800-32047822 TTAGAGTGATGGAAATATTCTGG - Intronic
904778011 1:32923816-32923838 TTGGAGTGATGGAAGTGTCCCGG + Intergenic
904871680 1:33623160-33623182 TTGGGGTGGTCAAAATGTTCTGG + Intronic
905882343 1:41472504-41472526 TTGGGGTGGTGAAAATGTTCTGG + Intergenic
906724180 1:48031798-48031820 TTGGAATGATGAAAATGTTCTGG + Intergenic
906922629 1:50080852-50080874 TTGGAGGGGTGAGAAGATCAGGG + Intronic
907143345 1:52209442-52209464 TTGGGGTGATGAAAATGTTCTGG - Intronic
907620151 1:55969309-55969331 TTGGGGTGATGAAAATTTTCTGG - Intergenic
907754275 1:57295119-57295141 TTGGAGTGATGAAAATATTTTGG + Intronic
908490419 1:64637993-64638015 ATGGAGGGGTGATAATATCCAGG + Intronic
908589026 1:65608801-65608823 TTGGATTATTGAAAATATCTTGG + Exonic
908603733 1:65770269-65770291 TGGGAGTGATAAAAATATTCTGG + Intergenic
909069009 1:70970963-70970985 TTAGAGTGATAAAAAAATCCAGG - Intronic
909464063 1:75953167-75953189 TTGGTCTGGTGATAATTTCCAGG - Intergenic
909550614 1:76895273-76895295 TTGGGGTGGTGAAAATTTTGGGG + Intronic
909654630 1:78017606-78017628 TTGGGGTGATGAAAATATTCTGG - Exonic
909792559 1:79696823-79696845 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
910437798 1:87222816-87222838 TGGGGGTGATGAAAATATTCTGG - Intergenic
911467904 1:98277816-98277838 TTGGTCTGGTGATAATTTCCAGG + Intergenic
912078119 1:105903378-105903400 TTTCATTGGTGAAAATGTCCAGG - Intergenic
912882600 1:113431866-113431888 TTGCAGAGGTTAAATTATCCTGG + Intronic
913354179 1:117900351-117900373 TTAGAGTGATGAAAATGTTCTGG - Intronic
913544643 1:119855376-119855398 TTGGTCTGGTGATAATTTCCAGG + Intergenic
913602147 1:120431923-120431945 TTGGTCTGGTGATAATTTCCAGG - Intergenic
913796228 1:122619988-122620010 TCTAAGTGGTCAAAATATCCAGG - Intergenic
913881135 1:124143344-124143366 TCTAAGTGGTCAAAATATCCAGG - Intergenic
913992031 1:143622247-143622269 TTGGTCTGGTGATAATTTCCAGG + Intergenic
914084903 1:144444712-144444734 TTGGTCTGGTGATAATTTCCAGG + Intronic
914190912 1:145409869-145409891 TTGGTCTGGTGATAATTTCCAGG + Intergenic
914363320 1:146955533-146955555 TTGGTCTGGTGATAATTTCCAGG - Intronic
914488356 1:148131606-148131628 TTGGTCTGGTGATAATTTCCAGG + Intronic
914588718 1:149086722-149086744 TTGGTCTGGTGATAATTTCCAGG + Intronic
915239765 1:154512096-154512118 TGGGGGTGATGAAAATATTCAGG - Intronic
915303922 1:154967206-154967228 TAGGAGAGGTTAAAATATTCTGG - Intronic
915439487 1:155935981-155936003 TTGGGGTGATGAAAATAATCTGG - Intergenic
916256067 1:162789468-162789490 TTGGTCTGGTGATAATTTCCAGG + Intergenic
916688014 1:167165196-167165218 TGGGGGTGATGAAAATATTCTGG - Intergenic
916716858 1:167454078-167454100 TTGGGATGGTGAAAATGTTCTGG + Intronic
916914486 1:169391589-169391611 TTGGTCTGGTGATAATTTCCAGG - Intronic
916962516 1:169903635-169903657 TTGGAGTGATGAAAGCATTCTGG + Intergenic
917098126 1:171420202-171420224 TTGGTCTGGTGATAATTTCCAGG + Intergenic
917232304 1:172851532-172851554 TTGGTCTGGTGATAATTTCCAGG - Intergenic
917239765 1:172935122-172935144 TGAGAGTGATGAAAATATTCTGG - Intergenic
917924870 1:179781192-179781214 TTAGGGTGATGAAAATATTCTGG + Intronic
917959507 1:180131118-180131140 TTGGGATGGAGAAATTATCCTGG + Intergenic
918957113 1:191222473-191222495 TTGGCATGGTGATAATTTCCAGG - Intergenic
919444820 1:197689844-197689866 TTAGAATGGTGACAATATGCTGG + Intronic
919884420 1:201922621-201922643 TGGGACTGATGAAAATATTCTGG + Intronic
920426823 1:205885046-205885068 TTGGAGTGGTGAAAAATTTTGGG + Intergenic
921108304 1:212006638-212006660 TTGGAGTAGGGAGAATATTCAGG - Exonic
921134263 1:212245964-212245986 TTTCAGTGATGAAAATATTCTGG + Intergenic
921418218 1:214915342-214915364 TTGGAGTGATGAAAACATTTTGG + Intergenic
921603253 1:217129849-217129871 TTGGAGTGATAAAAATGTTCTGG + Intronic
922248725 1:223826579-223826601 TTGGGGTGATGAAAATATTCTGG + Intronic
922363044 1:224840380-224840402 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
923118096 1:230962979-230963001 TTGGAGTGTTGAAAACAACTTGG + Intronic
923274806 1:232386686-232386708 TTGGAGGGGTGAAAAGAACCGGG + Intergenic
923396815 1:233573838-233573860 TTGGGGTAATGAAAATGTCCTGG - Intergenic
923445086 1:234063251-234063273 TTGGTCTGGTGATAATTTCCAGG - Intronic
923776935 1:236987202-236987224 TTGGGGTGATGAAAATATCCTGG - Intergenic
924391318 1:243562358-243562380 CTGGAGTGATGAAAATATTCTGG + Intronic
1062967052 10:1615745-1615767 CTGGAGAGGTGAAAGTGTCCTGG - Intronic
1063995970 10:11619909-11619931 TTGGGGTGATGAAAATATTTTGG - Intergenic
1064023232 10:11825983-11826005 TTGGAGTGATGAAAAAGTTCTGG - Intronic
1064206937 10:13332403-13332425 TTGGGGTGATGAAAACATTCTGG + Intronic
1064367627 10:14722137-14722159 TTAGAGTAATGAAAATATTCTGG - Intronic
1066053894 10:31662590-31662612 TCGGAGTGGTGGAAATAACCTGG - Intergenic
1066207822 10:33207175-33207197 TTGGAGTGATGGAAATATTTTGG + Intronic
1066655135 10:37691392-37691414 CTGGGATGGTGAAAATATTCTGG + Intergenic
1067040196 10:42947526-42947548 CTGGGGTGGTAAAAATATTCTGG + Intergenic
1067265687 10:44742252-44742274 TTGGAGTGATGAAAATGTTTTGG + Intergenic
1067328012 10:45288066-45288088 TTGGTCTGGTGAAAATTTCTGGG + Intergenic
1067674325 10:48357801-48357823 TTGGGGTGATGAAAATGTCCTGG - Intronic
1068591914 10:58861498-58861520 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
1068684495 10:59855651-59855673 TTGGGGTGATGAAAATGTTCTGG + Intronic
1069514032 10:69063565-69063587 TTGGAGTGATGAGAATGTTCTGG + Intergenic
1069523481 10:69145848-69145870 TTGGGGTGGTGAAAATGTTCTGG - Intronic
1069683658 10:70302499-70302521 TTGGAGTGATGAAAATATTTTGG + Intronic
1070300064 10:75197007-75197029 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1070430061 10:76328644-76328666 TGGCAGTGGTGAACATTTCCAGG - Intronic
1070838504 10:79467105-79467127 TCGGGGTGATGAAAATGTCCTGG + Intergenic
1071058796 10:81545314-81545336 TTGGAGTGATGAAAATATTCTGG + Intergenic
1071249319 10:83800949-83800971 TTGAAGAGGATAAAATATCCAGG - Intergenic
1071717286 10:88110145-88110167 TTGGGGTGATGAAAATATTCTGG + Intergenic
1072524714 10:96261357-96261379 TAGGGGTGATGAAAATATTCTGG - Intronic
1072753798 10:98003615-98003637 TTGGAATGGGGAGAATATTCTGG - Intronic
1072796920 10:98363154-98363176 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1072919010 10:99559781-99559803 TTGGAGTGATGGAAATATTCTGG - Intergenic
1073122096 10:101128435-101128457 TTGGAGTGATGAAAACATTCTGG - Intronic
1073393592 10:103199704-103199726 TTGGGGTGATGAAAACATTCTGG + Intergenic
1073487799 10:103831757-103831779 TTGGGGTGTTGAAAATGTTCTGG - Intronic
1074154176 10:110783842-110783864 TTGGAGTAATGAAAATATTCCGG - Intronic
1074179890 10:111050532-111050554 TTGGAGTGATGAAAATGTTTTGG - Intergenic
1074350610 10:112733332-112733354 TTGGGGTGGTGAAAATGTTTTGG - Intronic
1074562009 10:114543259-114543281 TTGGGGTGATGAAAATATTTTGG - Intronic
1074708653 10:116158706-116158728 TTGCAGTGGGGAGAATCTCCCGG - Intronic
1074806227 10:117055485-117055507 TTAGAGTGATGAAATTATTCTGG + Intronic
1075009476 10:118855554-118855576 TAGCGGTGATGAAAATATCCTGG + Intergenic
1075538640 10:123293929-123293951 TTGGGGTGATGAAAATATTTTGG + Intergenic
1076805382 10:132854756-132854778 TTGGAGTGATGAAAATGTCGTGG - Intronic
1078300294 11:10123072-10123094 TTGGAGTGGTGAAACCAAGCAGG - Intronic
1078313341 11:10268810-10268832 TTGGAGTTCTGAAAATTTCAAGG - Intronic
1079418738 11:20265916-20265938 TTGGAGTGATTAAAATATTCTGG - Intergenic
1079879331 11:25904774-25904796 TTGGAAGGGTGTATATATCCAGG + Intergenic
1080598642 11:33800847-33800869 TTGGCGTGATAAAAATGTCCCGG + Intergenic
1081344577 11:41967852-41967874 TTGAAGTGGGGAAAATAGCTTGG - Intergenic
1081357113 11:42124806-42124828 TTGGAGCGGCGAAAATTTCTGGG - Intergenic
1082011131 11:47450132-47450154 TTGGGGTGGTTAAAATGTTCTGG - Intergenic
1082011556 11:47453064-47453086 TTGGAGTGGGGAGAATCTGCTGG - Intergenic
1083045776 11:59733474-59733496 TTGGTCTGGTGATAATTTCCAGG + Intronic
1083425669 11:62584049-62584071 TTGGAGTGGTGAAAACATTCTGG + Intronic
1083840223 11:65300059-65300081 TTGGGGTGATGAAAATACTCTGG - Intronic
1084098137 11:66926662-66926684 TTGGAGTGATGAAAAGGTTCTGG - Intronic
1085132077 11:74049177-74049199 TTGGGGTGATGAAAATGTTCTGG - Intronic
1085652330 11:78279560-78279582 TTGGAGTGGTAAAAATGTTCTGG - Intronic
1085655305 11:78309334-78309356 TTTGGGTGATGAAAATATTCTGG - Intronic
1086120025 11:83296000-83296022 TTGGAGTGATGGAAATATTTTGG - Intergenic
1086134273 11:83431098-83431120 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
1086323973 11:85679836-85679858 TTGGAGAGGGGAAAATGTGCAGG + Intronic
1087016618 11:93560353-93560375 TTGCGGTGGTGAAAATGTTCTGG - Intergenic
1087197683 11:95317257-95317279 TTGGAGTGGCGAAAATTTTTGGG - Intergenic
1087410233 11:97782181-97782203 TTGGAAGGGTGTATATATCCAGG + Intergenic
1087699469 11:101419262-101419284 TAAGAGTGGTGAAAGTAGCCGGG + Intergenic
1087937504 11:104051959-104051981 TTGGAGTGATGAAAATGTTTTGG - Intronic
1088038977 11:105353240-105353262 CTGGATTGATGAAAATATTCTGG + Intergenic
1088272508 11:108049090-108049112 TTAGGGTGATGAAAATATTCTGG - Intronic
1088306947 11:108421022-108421044 TTGGAGTGATGAAAATATTGTGG - Intronic
1088772492 11:113049122-113049144 TTGGAGTGATGCAAATGTCTTGG + Intronic
1088912602 11:114203339-114203361 TTGGAGTGATGAAGATATTCTGG + Intronic
1089444494 11:118540996-118541018 TTGGGGTGATGAAAATGTTCTGG + Intronic
1089557507 11:119322486-119322508 TTGGAGTGATGACAAAATTCTGG - Intergenic
1089645344 11:119875278-119875300 TGGGAGTGGTGAAAAGCTCTTGG + Intergenic
1089799542 11:121013926-121013948 TTGGAGTGATGAAAAAGTTCTGG + Intergenic
1090275732 11:125418098-125418120 TTGGGGTGATGAAAATATTCTGG - Intronic
1090573171 11:128069729-128069751 TTGAAATGCTAAAAATATCCTGG - Intergenic
1090614941 11:128506168-128506190 TGGGAGTGATGAAAACATTCTGG + Intronic
1090650049 11:128798682-128798704 TTGGAAGGAGGAAAATATCCAGG - Intronic
1091505741 12:1066056-1066078 TTGGAGTGATGGAAATATTATGG + Intronic
1091579972 12:1779554-1779576 TTGGGGTGATGAAAATATTTTGG + Intronic
1093466729 12:19457028-19457050 TTGGAATGGTGACAACATGCTGG - Intronic
1093825003 12:23673808-23673830 TGGGAGTGATGAAAATGTTCTGG + Intronic
1093937557 12:25017789-25017811 TTGGAGTGGTGAAAATATCCTGG - Intergenic
1093954205 12:25197513-25197535 TTGGAGTGGTGGAACAATCACGG + Intronic
1094174677 12:27529227-27529249 AAGGAGAGGTGAAAATATCCAGG - Intronic
1094215528 12:27937263-27937285 TTGGGGTAATGAAAATATTCTGG + Intergenic
1094633337 12:32199532-32199554 TTGGTCTGGTGATAATTTCCAGG - Intronic
1094640693 12:32272294-32272316 TTGGTGTGGTGACAATTTCTAGG - Intronic
1094737244 12:33249019-33249041 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1094756895 12:33481719-33481741 TTGGAGTGATGAAAATGTCTTGG + Intergenic
1095283370 12:40383238-40383260 TTGGCCTGGTGATAATTTCCAGG + Intergenic
1095475738 12:42585725-42585747 TTGGAGCAGTGAAAAAAGCCTGG - Intronic
1095577098 12:43752772-43752794 TTGGGATGGTGAAAAAATTCTGG + Intronic
1096245378 12:49982167-49982189 TTGGTGTGGTGATAATTTCCAGG + Intronic
1096523671 12:52198323-52198345 TTGGAGGGGTGAAAAGATTAGGG + Intergenic
1096658577 12:53106680-53106702 TTGGCCTGGTGATAATTTCCAGG - Intronic
1096659274 12:53113656-53113678 TTGGCCTGGTGATAATTTCCAGG - Intronic
1096968959 12:55650207-55650229 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG + Intronic
1097892398 12:64791306-64791328 TTGGTGTGGTGAAAATGTTCTGG + Intronic
1098157151 12:67611207-67611229 TTGGAGTTAAAAAAATATCCAGG - Intergenic
1098348526 12:69531550-69531572 TTGGAGTGGTGAAAATATTATGG + Intronic
1098996646 12:77128409-77128431 TTGAAATGGTGAAAAAATTCTGG + Intergenic
1100558787 12:95726217-95726239 TTGGAGTGGTGAAAATGCTGTGG - Intronic
1100592503 12:96042698-96042720 TTGGTCTGGTGATAATTTCCAGG + Intronic
1101096147 12:101343437-101343459 TGGGAGTGATGAAAATGTTCTGG + Intronic
1101156722 12:101934662-101934684 TTGGGATGGTGAAAAATTCCTGG + Intronic
1101205356 12:102481738-102481760 CAGGAGTGGTGGAAATAACCTGG + Intergenic
1102044939 12:109823692-109823714 TTGGGGTGATGAAAATGTTCTGG + Intronic
1102137515 12:110587528-110587550 TTGGAGTGGTGAAAATATTCTGG + Intergenic
1102339400 12:112109680-112109702 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1102605172 12:114062890-114062912 TTGGAGTGGTGAAAAATTTGGGG - Intergenic
1103040682 12:117692942-117692964 TTGGGATGATGAAAATATTCTGG + Intronic
1103299312 12:119915804-119915826 TTGGGGTGATAAAAATATTCTGG - Intergenic
1103467242 12:121151724-121151746 TTGGGGTGATGAAAATGTTCTGG - Intronic
1103517965 12:121519672-121519694 TTGGGGTGATGAAAATGTTCTGG + Intronic
1103712899 12:122926129-122926151 TTAGGGTGATGAAAATGTCCTGG + Intronic
1103744608 12:123113793-123113815 TTGGGGTGATGAAAATGTTCTGG - Intronic
1103877817 12:124142333-124142355 TTGGGGTGATGAAAATGTTCTGG - Intronic
1104368163 12:128196596-128196618 TTGGAGTCCTGAAAATATTTTGG - Intergenic
1104670851 12:130678947-130678969 TGGAAGTGATGAAAATATCTTGG + Intronic
1105756962 13:23474848-23474870 TTGGGGTGATGAAAACATCCTGG - Intergenic
1106010452 13:25816056-25816078 TTGGAGTGATGAAAAAGTCCTGG + Intronic
1106030833 13:26000972-26000994 TTGGGGAGATGAAAATATTCTGG - Intronic
1106682256 13:32020001-32020023 TTGGAGTGATGGAAATGTGCTGG - Intergenic
1106943745 13:34802860-34802882 TTGGAGTGGCGAAAATTTTTGGG - Intergenic
1107068048 13:36238171-36238193 TTGGGGTGATGAAAATGTTCTGG + Intronic
1107371828 13:39759108-39759130 TTGGAGTGATAGAAATGTCCTGG + Intronic
1108106269 13:47013959-47013981 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1108381987 13:49863310-49863332 TTGGGGTGAGGAAAATATCTTGG - Intergenic
1108702785 13:52957896-52957918 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
1109303512 13:60614140-60614162 TTGGAGTGGTTAACATAACCTGG - Intergenic
1109753880 13:66733226-66733248 TTTGAGAGATGGAAATATCCTGG - Intronic
1110140386 13:72122075-72122097 TTGGTCTGGTGACAATTTCCAGG + Intergenic
1110385439 13:74905541-74905563 TTGGAGTGATAAAAATATTCTGG + Intergenic
1110475676 13:75910694-75910716 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1110564605 13:76945707-76945729 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1110600866 13:77372147-77372169 TTGGAGTGAAGAAAACATTCTGG + Intergenic
1110777683 13:79428835-79428857 TTGAAGTGTTGGAAGTATCCAGG - Intergenic
1111461162 13:88543959-88543981 TTGGGCTGGTGAATATAACCAGG - Intergenic
1112606059 13:100907708-100907730 TTGGGGTGATGAAAATATTTTGG + Intergenic
1112769517 13:102780635-102780657 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1114256237 14:21003780-21003802 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1114256806 14:21010185-21010207 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1114988314 14:28257437-28257459 TTGGAGTAATGAAAATGTTCTGG + Intergenic
1115110473 14:29815346-29815368 ATGGAGAGGTGAGAATATGCTGG - Intronic
1115490649 14:33954832-33954854 TTGGGGTGGTGAAAATGTTTTGG - Intronic
1115906205 14:38206048-38206070 TTTGAGTGGTGAAAATGTTCTGG - Intergenic
1116037424 14:39644282-39644304 TTGCAGTGATGAAAATGTTCTGG + Intergenic
1116953076 14:50896317-50896339 TTGGAGCGGTGAAAATTTTTGGG - Intronic
1117109583 14:52436462-52436484 TTGGGGTGATGAAAATGTTCTGG + Intronic
1117353001 14:54899736-54899758 TTGGAGTCATGAAAATGTTCTGG - Intronic
1117858049 14:60056110-60056132 TTGAGATGGTGAAATTATCCTGG - Intronic
1118440413 14:65806676-65806698 TTGGTGTGGGGCAAATAACCGGG - Intergenic
1118986707 14:70761859-70761881 TTGGGGTGGTGAAAATGTTTTGG - Intronic
1119024370 14:71140893-71140915 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1121192428 14:92042177-92042199 TTGGAGTGGTGAAAATTTTGGGG + Exonic
1121205696 14:92164875-92164897 TTGGAGTGATGAAAGTGTTCTGG - Exonic
1123694352 15:22866481-22866503 TGGAAGTGTTGAATATATCCAGG - Exonic
1123913760 15:24999340-24999362 TTGGTGTGGTGACAATTTCCAGG - Intergenic
1124054798 15:26232389-26232411 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1124897378 15:33789510-33789532 TTGGGGTGATGAAAACATCGTGG + Intronic
1125346676 15:38725586-38725608 TTGGGGTGATGAAAATATTCTGG + Intergenic
1125496801 15:40203429-40203451 TTGGAGTGATGAAAGTATTCTGG + Intronic
1125629731 15:41137361-41137383 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1125850195 15:42895868-42895890 TTGGGATGGTGAAAATGTTCTGG - Intronic
1125988970 15:44086594-44086616 TTGGGGTGATGAAAGTATTCTGG + Intronic
1126588611 15:50316560-50316582 TTGGAGTGGAGAAAATCTTTAGG - Intronic
1127116115 15:55729402-55729424 TTGGGGTGATGAAAATTTTCTGG + Intronic
1127125228 15:55805205-55805227 TTTGAGTCCTGAAAATATCTTGG - Intergenic
1127356254 15:58203467-58203489 TTGAAGTGATGAAAATGTTCTGG + Intronic
1127480737 15:59374442-59374464 TTGAAGTGATGAAAATATTCTGG + Intronic
1128162435 15:65432537-65432559 TTGGGATGATGAAAATATTCTGG + Intergenic
1128178964 15:65583573-65583595 TTGGAGTGATTAAAATGTTCTGG + Intronic
1128395917 15:67225508-67225530 CTGGGGTGGTGAAAATGTTCTGG - Intronic
1128421911 15:67500009-67500031 TTGGGGTGATGAAAATGTTCTGG + Intronic
1128465967 15:67911682-67911704 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1128846010 15:70895565-70895587 TTGGAATGATGAAAAAATTCTGG - Intronic
1129952924 15:79607760-79607782 TTGGAGTGATGAAAAAGTTCTGG + Intergenic
1130215950 15:81969807-81969829 TGGGGGTGATGAAAATATTCTGG + Intergenic
1131006847 15:88985413-88985435 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1131721660 15:95175259-95175281 TTGGCATGGTGAAAATATTTTGG + Intergenic
1131745709 15:95445073-95445095 TTGGAGTTTTGAAAATGGCCTGG - Intergenic
1133433680 16:5760877-5760899 TTGGGGTGATGAAAATATTTTGG + Intergenic
1133473710 16:6099573-6099595 TTGGTGTGATGAAAATATTTTGG + Intronic
1134420974 16:14089256-14089278 TTGGGGTGATGAAAGTGTCCTGG - Intronic
1134759579 16:16702215-16702237 TTGGAGTGATGAAAATGTTCTGG - Intergenic
1134859170 16:17545725-17545747 TTGGGCTGATGAAAATATCCTGG - Intergenic
1134986491 16:18656986-18657008 TTGGAGTGATGAAAATGTTCTGG + Intergenic
1135173124 16:20204065-20204087 TGGGAGTGATGAAAAAATGCTGG - Intergenic
1135979243 16:27134267-27134289 TTGGAATGGTGACAACATGCTGG - Intergenic
1138100852 16:54251378-54251400 TTGGGGTGATGAAAATATTCTGG + Intronic
1138279041 16:55759031-55759053 TGGGGGTGGTAAAAATGTCCTGG - Intergenic
1138289499 16:55834650-55834672 TGGGGGTGGTAAAAATGTCCTGG + Intergenic
1138544713 16:57709747-57709769 TTGGGGTGATGAAAAAATTCTGG - Intronic
1138729108 16:59175485-59175507 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1138992324 16:62406626-62406648 TTGGACTGATGGAAATATTCTGG - Intergenic
1139332053 16:66200636-66200658 TTGGGGTGATGAAAACATTCTGG + Intergenic
1139624500 16:68175310-68175332 TTGGAGTGATGGAAATCTTCTGG + Intronic
1139796327 16:69486005-69486027 TCGAAGTGATGAAAATATCCTGG - Intergenic
1140097423 16:71886764-71886786 TTGGGGTGATGAAAATATTCCGG - Intronic
1140758202 16:78087987-78088009 ATGGAGTAGTGAAAATCTCTTGG + Intergenic
1141600856 16:85125384-85125406 TTGGGGTGATGAAAATGTTCTGG + Intergenic
1143354111 17:6312369-6312391 TTGGAGTGATGAAAATATTTTGG + Intergenic
1143738972 17:8938479-8938501 TTGGAGCGATGAAAATATTCTGG - Intronic
1143931057 17:10425498-10425520 TTGGGGTGATGAAAACATTCTGG + Intergenic
1144375801 17:14639869-14639891 ACGGAGTGATGAAAATATTCTGG + Intergenic
1144615540 17:16767991-16768013 TTGGTGTGGTAATAATTTCCAGG - Intronic
1144897163 17:18547685-18547707 TTGGTGTGGTAATAATTTCCAGG + Intergenic
1144995777 17:19267271-19267293 TTGGAGTGTTGAAAATGTTTTGG + Intronic
1146306997 17:31737927-31737949 TTAGAGTGGTGATATTATACGGG + Intergenic
1146401357 17:32502451-32502473 TTGGGGTGATGAAAATATTCCGG + Intronic
1147805605 17:43128598-43128620 TTGGGGTGGTGACACTATCTTGG + Intergenic
1150027642 17:61694187-61694209 TTGGGGTGGTGAAAATGTTCTGG - Intronic
1150243363 17:63654170-63654192 TTGGAGTGATAAAAATGTTCTGG - Intronic
1150728244 17:67668996-67669018 TTGGAGTGATGAAAACATTCTGG - Intronic
1151220517 17:72608838-72608860 TGGGGGTGCTGAAAATATTCTGG + Intergenic
1151709331 17:75792706-75792728 TGGGAGTGATGGAAATATTCTGG + Intronic
1152075920 17:78159668-78159690 TTGGGGTGATGAAAATCTCTCGG - Intronic
1152372698 17:79900071-79900093 TTGGGGTGATGAAAATATTTTGG + Intergenic
1152536507 17:80953207-80953229 CTGGAGTGGTGAGAATCTTCTGG - Intronic
1153204002 18:2677536-2677558 TTGGAGTTGTAAAAATATTCTGG - Intronic
1153866519 18:9274597-9274619 TTGGAGTGATGGAAATGTTCTGG + Intronic
1154192210 18:12239694-12239716 TTGGAATGATGAAAAAGTCCTGG - Intergenic
1154192359 18:12241356-12241378 TTGGAGTGATGAAAATGTTTTGG - Intergenic
1154210160 18:12372928-12372950 CTGGAGTGCTGAAAATGTTCTGG + Intronic
1154959348 18:21292461-21292483 TGGGGGTGATGAAAATGTCCTGG - Intronic
1155221094 18:23686667-23686689 TTGGAGTGATAAAAATGTTCTGG - Intergenic
1155526211 18:26718597-26718619 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1156082150 18:33350383-33350405 TTGGAGTGATGAAAATATATTGG - Intronic
1156225166 18:35098150-35098172 CTGGAGTGGTGCAAATGGCCTGG + Intronic
1156237929 18:35222031-35222053 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1156317382 18:35983035-35983057 TTAGGGTGATGAAAATATTCTGG + Intergenic
1156371152 18:36472507-36472529 TTGGGGTGATGAAAATGTTCTGG - Intronic
1156493319 18:37509364-37509386 TGTGTGTGGTGAAAAAATCCAGG + Intronic
1156952004 18:42912405-42912427 TTGCAGTGGCTAAAATTTCCAGG - Intronic
1157549416 18:48570917-48570939 TTGGTGTGTTGAAAATGTTCTGG + Intronic
1158504096 18:58030758-58030780 TTGGAGTGTTGATAAGGTCCAGG + Intergenic
1158743677 18:60172295-60172317 TTGGAGTGATAAAAATGTTCTGG + Intergenic
1158933693 18:62345603-62345625 TTGGGGTGATGAAAATGTTCAGG + Intronic
1159275501 18:66215738-66215760 TTGGAGTGTTGAAAATATTATGG - Intergenic
1161113450 19:2483082-2483104 TGGGGGTGATGAAAATATTCTGG - Intergenic
1161475918 19:4485105-4485127 GTGAAGCGTTGAAAATATCCTGG - Intronic
1161771364 19:6232744-6232766 TGGGGGTGATGAAAATATGCTGG + Intronic
1162089894 19:8272337-8272359 TTGGGGTCATGAAAATATTCTGG + Intronic
1162092125 19:8287193-8287215 TTGGGGTCATGAAAATATTCTGG + Intronic
1162855605 19:13466055-13466077 TAGGGGTGGTGAAAATGTTCTGG + Intronic
1162872354 19:13595856-13595878 TTGGAGTGATGAAAAAGTTCTGG + Intronic
1163052681 19:14696288-14696310 TTGGCGTGATGAAAATGTTCTGG - Intronic
1164041920 19:21500412-21500434 TTGGTCTGGTGATAATTTCCAGG - Intronic
1164259204 19:23554559-23554581 TTGGGGTGGTGAAAATTTTGGGG - Intronic
1164458981 19:28431674-28431696 TTGGAGTGGCGAAAATTTTTGGG + Intergenic
1165155546 19:33785008-33785030 TTGACGTGGGGAAATTATCCTGG + Intergenic
1165174769 19:33920383-33920405 TTAGGGTGGTGAAACTATTCTGG + Intergenic
1165437637 19:35805121-35805143 TTGGGGTGATGAAAATATTGTGG + Intronic
1165971560 19:39635670-39635692 TTGGAGGGGTGTAAGTATCCAGG + Intergenic
1166033464 19:40150266-40150288 TTGGAGTGATGAAAATGTTCTGG + Intergenic
1166408606 19:42541319-42541341 TTGGGGTGATGAAAATTTTCTGG + Intronic
1166439244 19:42796762-42796784 TGGGAGAGGTGAGATTATCCAGG + Intronic
1166978428 19:46618741-46618763 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1167783383 19:51615582-51615604 TTGGAGTGGAGAAAATGGCAAGG - Intronic
1168203714 19:54834595-54834617 TTGGAGTGGAGATATGATCCTGG + Intronic
1168283973 19:55321356-55321378 TTGGAGAGGTGAGCATCTCCAGG - Intronic
1168688048 19:58360193-58360215 TGGGAGTGATGAAAATATTCTGG + Intronic
925663727 2:6230900-6230922 TTTGTGTTGAGAAAATATCCTGG + Intergenic
925695003 2:6567215-6567237 TAGGAGTGGTAGAAATACCCAGG + Intergenic
925857124 2:8139991-8140013 TTGGGGTGATGAAAATCTCTTGG + Intergenic
926013357 2:9425853-9425875 TGGGAGTGATGAAAATGTGCTGG - Intronic
926644668 2:15276561-15276583 TGGGAGTAGTGAAAAAATCCTGG + Intronic
926693907 2:15757246-15757268 TTGGGGTGATGAAAATGTTCTGG + Intergenic
927688883 2:25193413-25193435 TTTGGGTGGTGAAAATGTTCTGG + Intergenic
927780335 2:25934269-25934291 TTGGAGTGATGAAAATGTTCTGG + Intronic
928036015 2:27823989-27824011 TTGGGGTGATGAAAATGTTCTGG - Intronic
928391795 2:30916276-30916298 TTGGTCTGGTGATAATTTCCAGG + Intronic
928623492 2:33115390-33115412 TTGGGGTGATGAAAATGTTCTGG + Intronic
929229479 2:39544510-39544532 TTGGAGTGATGAAAAATTTCTGG + Intergenic
929478239 2:42275735-42275757 TTGGTATGGTGAAAATTTCTGGG - Intronic
929498783 2:42471534-42471556 TTGGGGTGATGAAAATGTTCTGG + Intronic
929794264 2:45047033-45047055 TTGGAGTGATGAAAATATTCTGG + Intergenic
929869884 2:45750225-45750247 TTGGGGTGATAAAAATATTCTGG - Intronic
930506434 2:52287461-52287483 TTGGTCTGGTGAAAATTTCCAGG - Intergenic
930696328 2:54415824-54415846 TTGGGTTGATGAAAATATTCTGG - Intergenic
931508083 2:62954452-62954474 TTTGGGTGATGAAAATGTCCTGG + Intronic
931724737 2:65098639-65098661 CTGGAGTGAAGAAAATGTCCTGG - Intronic
931945883 2:67306844-67306866 TTGGAATGATGAAAATGTTCTGG - Intergenic
932059053 2:68476793-68476815 TTGGAGTGATGAATACATCCTGG + Intronic
932120899 2:69099056-69099078 TTGGAGTGATGAAAATATTCTGG - Intronic
932124478 2:69131406-69131428 ATGAAGTGTTGAAAATAACCCGG - Intronic
932146199 2:69319564-69319586 TTGAAGTGGTAAAAATAAGCTGG - Intergenic
932696482 2:73961147-73961169 TTGGGGTGATGAAAATGTTCTGG - Intergenic
933079697 2:77970346-77970368 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
933476616 2:82799564-82799586 TTGGTCTGGTGATAATTTCCAGG - Intergenic
933814813 2:86057842-86057864 TTGGAGTGATGGAAATGTTCTGG + Intronic
933884885 2:86709760-86709782 TTGGGGTGATGAAAAGATTCTGG - Intronic
933925288 2:87086931-87086953 TTGGGGTGATGAAAAGATTCTGG + Intergenic
935052404 2:99534983-99535005 TTAGGGTGATGAAAATATTCTGG - Intergenic
935249083 2:101245884-101245906 TTGGTCTGGTGATAATTTCCAGG - Intronic
935801195 2:106698069-106698091 TTGGAATGGTGACAACATGCTGG - Intergenic
935943201 2:108262888-108262910 TTGGTTTGGTGATAATTTCCAGG - Intronic
935972479 2:108543785-108543807 TTGGTCTGGTGATAATTTCCAGG + Intronic
936976269 2:118224854-118224876 TTGGACGGGAGAAAATATACGGG - Intergenic
937540102 2:122939248-122939270 TTGGAGTGATGAAAATCTTTTGG - Intergenic
937540969 2:122952966-122952988 TTGGAGTGATGAACATATTCTGG + Intergenic
938721785 2:134073781-134073803 GTGGGGTGATGCAAATATCCTGG + Intergenic
938846134 2:135211224-135211246 TTGGAGTGATGAAAATATTCTGG - Intronic
939098945 2:137872240-137872262 TTGGTCTGGTGATAATTTCCAGG - Intergenic
939505383 2:143039644-143039666 TTGGTCTGGTGATAATTTCCAGG - Intronic
939760306 2:146168120-146168142 TTGGAGTGATGAAAATGTTTTGG - Intergenic
939873699 2:147552974-147552996 TTGGAGTGGTGAAAACTTTCTGG - Intergenic
940235848 2:151509946-151509968 TTGGCCTGGTGATAATTTCCAGG - Intronic
940305840 2:152225250-152225272 TTAGAGTGGTGAAAATGTTTTGG - Intergenic
940726919 2:157344931-157344953 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
940858235 2:158746453-158746475 TTGGAATGATGAAAATGTACTGG - Intergenic
940958882 2:159760055-159760077 TTGGAGTGATGAAAATGTTTTGG - Intronic
941340817 2:164301063-164301085 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
941642860 2:168007990-168008012 TTGGGGTGATGAAAATGTTCTGG - Intronic
941785242 2:169490756-169490778 TGGGAGTGATGAAAATATTCTGG - Intronic
942053302 2:172161332-172161354 TTGGAGTGATGAAAATATTTTGG - Intergenic
942255757 2:174096317-174096339 TTGGGGTGATGAAAATGTTCTGG + Intronic
942622801 2:177865893-177865915 TTGGAGTGATGAAAATGTTCTGG + Intronic
943227595 2:185199468-185199490 TTGGTCTGGTGATAATTTCCAGG + Intergenic
943531567 2:189088146-189088168 TTGGATTGCTCCAAATATCCAGG + Intronic
943702083 2:190997319-190997341 TTCGTGTGGTAAAAGTATCCAGG - Intronic
944210732 2:197203994-197204016 TTGGGGTGGTGAAAATGTTCTGG + Intronic
944303424 2:198151641-198151663 TTGGTGTGATGAAAATGTTCTGG + Intronic
944480015 2:200147220-200147242 TTGGAATGATGAAAATATTCTGG + Intergenic
944485661 2:200202304-200202326 TTGGGGTGGTGAAAATTTTTTGG + Intergenic
945262617 2:207858901-207858923 TTGGGGTGATGAAAATGTTCTGG - Intronic
945555183 2:211267204-211267226 TTGGGGTGGTGAAAATTTTTTGG - Intergenic
946343621 2:219089624-219089646 TTGGGGTGATGAAAATGTTCTGG + Intronic
947173373 2:227335398-227335420 TTGGGCTGATGAAAATATTCCGG + Intronic
947504938 2:230700951-230700973 TTGAAGTGGGGAAATTATCCAGG - Intergenic
947814853 2:233029816-233029838 TTGGGGTGGTGAAAATATTCTGG + Intergenic
947832947 2:233154535-233154557 TTGGTCTGGTGATAATTTCCAGG - Intronic
948030820 2:234815969-234815991 TTGGGGTCATGAAAATTTCCTGG + Intergenic
948448502 2:238052772-238052794 TTGGGGTGTTGAAAATATTCTGG + Intronic
1168875279 20:1167458-1167480 TTGAGGTGGTGAAAATGTTCAGG - Exonic
1168980611 20:2000503-2000525 TTGGGGTGATGAAAACATTCTGG + Intergenic
1169043270 20:2514018-2514040 TTGGGGCGATGAAAATATTCTGG + Intronic
1169448923 20:5694831-5694853 TTGGAATGGGGAGATTATCCTGG - Intergenic
1169848100 20:10017457-10017479 TTGGAGTGATGAAAATATTCTGG + Intronic
1170102562 20:12718523-12718545 TTGGAGTGATGAAAATATTCTGG + Intergenic
1170288266 20:14736367-14736389 TTGGAGTGATGAAAATGTTGTGG + Intronic
1171007892 20:21485499-21485521 TTGGAGTGGTGAAAATATCTTGG + Intergenic
1171230800 20:23482709-23482731 TTGGAGATGTGAAAAAAACCTGG + Intergenic
1171230967 20:23484736-23484758 TTGGAATGGAGAGATTATCCTGG + Intergenic
1172537636 20:35686408-35686430 ATGAAGTGATGAAAATGTCCTGG + Intronic
1172611727 20:36257453-36257475 TTGGGGTGATGAAAATATTCTGG + Intronic
1172918232 20:38460424-38460446 TCGGAGTGCTGCAAAAATCCTGG - Intergenic
1173545214 20:43892474-43892496 TTAGAGTGATGAAAATGTTCTGG + Intergenic
1173680607 20:44877882-44877904 TTGGAGTGGTGAAAAGGGACAGG - Intergenic
1174297535 20:49559841-49559863 TAGGGGTGATGAAAATATTCTGG + Intronic
1174629471 20:51943815-51943837 GTGGAGTGATGAAAATATTTTGG - Intergenic
1175237063 20:57521967-57521989 TTGGGGTGATAAAAATATTCTGG + Intronic
1175266740 20:57708091-57708113 TTCAAGTGGTAAAAATAACCAGG - Intronic
1175448935 20:59045862-59045884 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1176274093 20:64254127-64254149 TTGGTATGGTGATAATTTCCAGG + Intergenic
1176422306 21:6526003-6526025 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1176686116 21:9849895-9849917 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
1177120067 21:17127273-17127295 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1177173159 21:17676036-17676058 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1177331707 21:19673287-19673309 TGGGAGTGGTGAAATTTTCTGGG - Intergenic
1177787410 21:25686110-25686132 TTGGAGTGATGAAAACATTTTGG - Intronic
1178045771 21:28693041-28693063 GTGGGGTGATGAAAATATTCTGG + Intergenic
1178564005 21:33666324-33666346 TTGGGGTGATGAAAATGTTCTGG + Intronic
1178574441 21:33772473-33772495 CTGGAGTGATGAAAATGTTCTGG - Intronic
1179697797 21:43134319-43134341 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1179954829 21:44732800-44732822 TTGGAGTGGGGACAGTTTCCTGG - Intergenic
1182501041 22:30747841-30747863 TGGCAGTGAAGAAAATATCCAGG - Intronic
1182504933 22:30775140-30775162 TTGGAGTGATGAAAACGTTCTGG - Intronic
1182862941 22:33576480-33576502 ATGGGATGGTGAAGATATCCAGG + Intronic
1183417649 22:37691680-37691702 TTGGGGTGGTGGAAATGGCCAGG + Exonic
1183557170 22:38538308-38538330 TTGGAGTCGTGACAACATCTGGG + Exonic
1183973525 22:41496500-41496522 TTGGAGAGGTTAAATTGTCCAGG + Intronic
1184277189 22:43415902-43415924 TTGAAGTGATGAAATTAGCCTGG - Intronic
1184475323 22:44717493-44717515 CTGGGGTGATGAAAATCTCCTGG - Intronic
1184518818 22:44980185-44980207 TTGGAGTGGTGAAAATGTCCTGG - Intronic
949190091 3:1241290-1241312 TTGGGGTGGTGAAAATTTTTGGG + Intronic
950235057 3:11312061-11312083 TTGGAGTGATGAAAATATTCTGG + Intronic
950246221 3:11421540-11421562 TAGGTGTGGTGAAAAAATCAAGG - Intronic
950926916 3:16749544-16749566 TTGGGGTGGTGAAAATTTTTTGG - Intergenic
951106685 3:18752198-18752220 CTGGAGTAATGAAAAGATCCTGG + Intergenic
951234795 3:20221701-20221723 TTGGAGTTGTAAAAACATTCAGG - Intergenic
951895093 3:27602625-27602647 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
952680815 3:36089359-36089381 TTGAAGTGATGAAAATGTTCTGG - Intergenic
952910379 3:38179570-38179592 TTGGAGTTATGAAAACATTCTGG - Intronic
952966974 3:38627355-38627377 TTGGGGTGGTGCAAATGTTCTGG + Intronic
953052572 3:39359128-39359150 TTGGAATGGTGACAACATGCTGG + Intergenic
953278621 3:41530013-41530035 TTGCAGAGATGAAAATATTCTGG + Intronic
953338488 3:42113928-42113950 TTGGGGTGATGAAAATGTTCTGG - Intronic
953657897 3:44868058-44868080 TTGGAGTGATAAAAATGTTCTGG - Intronic
953836073 3:46345393-46345415 TTGGAGTGATGAAAATGTTTTGG - Intergenic
953921981 3:46958449-46958471 TTGGTCTGGTGATAATTTCCAGG + Intronic
954649601 3:52153063-52153085 TTGGGATGATGAAAATATTCTGG + Intronic
954888799 3:53903806-53903828 TTGGTCTGGTGATAATTTCCAGG - Intergenic
954893165 3:53950934-53950956 TTGGAGGGATGAAAATGTTCCGG + Intergenic
955182943 3:56688854-56688876 TTGGGGTGATGAAAATATTCTGG + Intergenic
955210199 3:56934176-56934198 GTGAAGTGGGGCAAATATCCTGG - Intronic
955718464 3:61856247-61856269 TTGGAGTGATTAAAATGTTCTGG - Intronic
955829435 3:62985489-62985511 TTCAAGTGGTGAAGATAACCAGG - Intergenic
955898736 3:63728733-63728755 TTCAACTGGTGAAAATATGCTGG + Intergenic
955915322 3:63902027-63902049 TTGGAGTGATGAAAATGTTCTGG + Intronic
956234608 3:67054849-67054871 TAGGAGTGATGAAAATGTTCTGG - Intergenic
956380205 3:68657106-68657128 TTGGTCTGGTGATAATTTCCAGG + Intergenic
956549345 3:70441058-70441080 TTGGAGTGATAAAATTATTCAGG + Intergenic
957151736 3:76494938-76494960 TTGGGGTGATGAAAATATTTTGG + Intronic
957200035 3:77122034-77122056 GTGAAGTGGAAAAAATATCCAGG - Intronic
957352749 3:79047449-79047471 TTGGAGTGCTGATCAGATCCAGG + Intronic
958269835 3:91486016-91486038 TTGGTGTAGTGATAATATACTGG - Intergenic
958471543 3:94527004-94527026 TTGCAATGGAGAAAATATGCAGG + Intergenic
959167430 3:102798133-102798155 TTGTACAGGTGAAAATACCCAGG + Intergenic
959643561 3:108670245-108670267 TTGGAGTGATAAAAATGTTCTGG - Intronic
959865049 3:111257245-111257267 TTTGTGTGGTGAAAAAATCAGGG + Intronic
960222696 3:115133476-115133498 TTGGAGTGATGAGAATGTTCTGG - Intronic
960224532 3:115154257-115154279 TTGAAATGGGGAAAATATCCTGG - Intergenic
960860823 3:122151601-122151623 TTGGAGTGATTAAAATCTTCTGG - Intergenic
961460689 3:127048341-127048363 TTGGGGTAATGAAAATGTCCTGG - Intergenic
961481849 3:127185842-127185864 TTGGAGTGATGAAAATATTCTGG - Intergenic
961703939 3:128769193-128769215 TTGGGGTGATGAAAATGTTCTGG - Intronic
962183038 3:133228067-133228089 TTTGAGTGATGAAAACATTCTGG + Intronic
962447448 3:135479806-135479828 GTGGAGTTGGGAAAATATCATGG - Intergenic
963192733 3:142491086-142491108 TTGGAGTGATGAAAATGTTCTGG - Intronic
963257144 3:143156762-143156784 TTGGAGTTCTTTAAATATCCTGG - Intergenic
964465370 3:156985867-156985889 TTGAAATGGGGAAATTATCCTGG + Intronic
964788103 3:160421831-160421853 TGGGAGTGATAAAAATATCTTGG - Intronic
965140351 3:164825310-164825332 TTGGTCTGGTGATAATTTCCAGG + Intergenic
965593776 3:170387277-170387299 TTGGAGTGATGAAAACATTATGG - Intronic
965950181 3:174299320-174299342 TTGAAATGGAGAAACTATCCTGG + Intergenic
966682230 3:182655006-182655028 TTGGGGTGATGAAAATGTTCTGG + Intergenic
966794550 3:183700940-183700962 TTGGAGTGATGAAAACATTATGG + Intronic
967243535 3:187464729-187464751 TTGGAGTGGAGATAAAATCATGG + Intergenic
968821439 4:2855125-2855147 TTGGGATTGTGAAATTATCCTGG - Intronic
969338522 4:6526440-6526462 TTGGGGTGATGAAAATGTTCTGG + Intronic
969438317 4:7201191-7201213 TTGGAATGGTGAGAATATTAAGG + Intronic
970067944 4:12120548-12120570 TTGGTCTGGTGATAATTTCCAGG + Intergenic
970184686 4:13438370-13438392 TTGGTGTGATGAAAATGTTCTGG - Intronic
970513635 4:16805545-16805567 TTGGAGTAGAGAGAAAATCCAGG + Intronic
970672013 4:18407473-18407495 CAGGATTGGGGAAAATATCCAGG - Intergenic
971392567 4:26199733-26199755 TGGGGGTGTTGAAAATGTCCTGG + Intronic
971571025 4:28210684-28210706 TTGAAATGTTAAAAATATCCAGG - Intergenic
972292830 4:37705956-37705978 TTGGGGTGATGAAAATGTTCTGG - Intergenic
973916699 4:55641045-55641067 TTGGGGTGATGAAAATGTTCTGG + Intergenic
973998865 4:56489537-56489559 ATGGAGTAGTGAAAAAATTCAGG + Intronic
974102320 4:57430622-57430644 TTCCAGTGTAGAAAATATCCAGG - Intergenic
975553220 4:75634129-75634151 TTGGGGTGATGAAAATGTTCTGG + Intergenic
976589348 4:86833813-86833835 CTGGGGTGATGAAACTATCCTGG - Intronic
976719060 4:88152781-88152803 TTGGGGTGGTGAAAATTTTTGGG + Intronic
977010707 4:91629173-91629195 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
977074782 4:92439457-92439479 TTGGGGTGGTGAAAATTTTTAGG + Intronic
977216739 4:94293738-94293760 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
977766932 4:100809802-100809824 TTGGAGTGCTGAAACTATTTTGG - Intronic
977921072 4:102643058-102643080 TTGGGGTGATGAAAATATTCTGG - Intronic
978873361 4:113607460-113607482 CAGGAGAGGTGAAAATAGCCAGG + Intronic
979915690 4:126430839-126430861 TTGGCCTGGTGAAAATACTCTGG + Intergenic
980349570 4:131668377-131668399 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
980535604 4:134117407-134117429 ATGGAATGATAAAAATATCCAGG + Intergenic
981088961 4:140712949-140712971 TTGGTCTGGTGATAATTTCCAGG - Intronic
981263850 4:142757199-142757221 TTGGACTGTTGATAATATCAGGG - Intronic
981365754 4:143900868-143900890 TTGGAGTGATGAAAATGTTCTGG + Intronic
981375854 4:144014666-144014688 CTGGAGTGATGAAAATGTTCTGG + Intronic
981386377 4:144136047-144136069 TTGGAGTGATGAAAATGTTCTGG + Intronic
982107991 4:152027886-152027908 TTGGAGTGATAAAAATGTCCTGG + Intergenic
982858022 4:160409978-160410000 TTGAAATGGAGAAATTATCCTGG + Intergenic
983075481 4:163320356-163320378 TTGGAGTAGTGAAAATTCTCTGG + Intergenic
983113742 4:163785863-163785885 CTGGGATGGTGAAAATATTCTGG + Intronic
984247756 4:177296006-177296028 CTGGACTGGTGAACACATCCAGG - Intergenic
984412228 4:179408852-179408874 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
986826596 5:11528988-11529010 ATGGAGTGATGAAAATATGTGGG + Intronic
987341710 5:16945176-16945198 TTGGAGGGATGAAAATATTCTGG - Intergenic
987821827 5:22974836-22974858 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
988927671 5:36005834-36005856 TTGGTCTGGTGATAATTTCCAGG - Intergenic
989038219 5:37197826-37197848 TTGGGGTGATGAAAATGACCTGG - Intronic
989621541 5:43389186-43389208 TTGGAGTGATGAAAATGTGCTGG + Intronic
989632094 5:43495852-43495874 TTGGAATGGTGACAACATGCTGG - Intronic
990585243 5:57205055-57205077 TTGGGGTGATGAAAACATTCTGG - Intronic
991528253 5:67587681-67587703 TGGGATTGATGAAAATATTCTGG + Intergenic
992423690 5:76633640-76633662 TTGGTGTGATGAAAATGTTCTGG - Intronic
993034156 5:82738671-82738693 TTGGAGTTTTGAAAAGAGCCTGG - Intergenic
993312569 5:86354208-86354230 TTGGAGTGATGGAAATATTCTGG - Intergenic
993633702 5:90318419-90318441 TTGGTGGGGTGAAAATTTGCTGG + Intergenic
993683522 5:90909297-90909319 TTGGAATGGTCAAAAGATCAAGG - Intronic
993699053 5:91096817-91096839 TTGGAGTGATGAAAAAGTTCTGG - Intronic
993705557 5:91165851-91165873 TTGGAGTGATGAAAACATTCTGG - Intergenic
993837100 5:92829203-92829225 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
994168319 5:96631205-96631227 TTGGGGTGATGAAAATGTTCTGG - Intronic
994920948 5:106042309-106042331 TTGGGGTGATGAAAATGTACTGG + Intergenic
994989962 5:106983561-106983583 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
995124635 5:108568128-108568150 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
995688727 5:114799881-114799903 TTGGTCTGGTGATAATTTCCAGG + Intergenic
996555564 5:124775471-124775493 TTGGAGTGATGAAAATGTTTTGG + Intergenic
997342226 5:133153657-133153679 TTGGAGTGAAGAAAATGCCCAGG + Intergenic
997788948 5:136739168-136739190 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
997883268 5:137609535-137609557 TTGGGGTGATGAAAATGTTCTGG - Intergenic
998089838 5:139358904-139358926 TTGGGGTGGTGAAAATGTTCTGG + Intronic
998239965 5:140432191-140432213 TTGGATTGATGAAAATGTTCTGG - Intronic
998565896 5:143215564-143215586 TGGGGGTGATGAAAATATTCTGG - Intronic
998795635 5:145815507-145815529 TTGGGGTGATGAAAATGTCCTGG - Intronic
999054044 5:148554599-148554621 TTGGAATGATGAAAAAATTCTGG + Intronic
999403391 5:151284990-151285012 TTGGGGTGATGAAAATGTTCTGG - Intronic
1000305719 5:159992762-159992784 TTGGAGTGATAAAAATGTTCTGG + Intergenic
1000853129 5:166364571-166364593 TTGGAGTTTTGAAACTGTCCAGG + Intergenic
1001416600 5:171549161-171549183 TTGGAGTGATGAAAATGGTCTGG + Intergenic
1002344674 5:178539664-178539686 ATTCACTGGTGAAAATATCCAGG - Intronic
1002428585 5:179190202-179190224 TTGGGGTGGTGAAAATTTTTGGG + Intronic
1002965492 6:1962180-1962202 TTGGGGTGATGAAAATGTTCTGG - Intronic
1003027448 6:2568316-2568338 TTAGGGTGGTGAAATTATTCTGG - Intergenic
1003092672 6:3117606-3117628 TTGGAGAGATGAAAAAGTCCTGG - Intergenic
1003100559 6:3173371-3173393 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1003106525 6:3220759-3220781 TTTGGGTGATGAAAATATTCTGG + Intergenic
1004455899 6:15791131-15791153 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1004615973 6:17289293-17289315 TTGGAGAGCCTAAAATATCCTGG - Intronic
1004635366 6:17462493-17462515 TGGGGGTGGTGAAAATGTTCGGG - Intronic
1006995415 6:38255309-38255331 TTGGGGTGATGAAAATGTTCTGG + Intronic
1007455748 6:41975669-41975691 TGGGAGTAGTGAAAATTTCCAGG + Intronic
1009751231 6:67881487-67881509 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
1010229011 6:73518946-73518968 TTGGAATGGTGACAACATGCTGG - Exonic
1010760872 6:79721532-79721554 TTGGAGTTGGGATACTATCCAGG - Intergenic
1010770485 6:79823037-79823059 TTGCTGGGGTTAAAATATCCTGG - Intergenic
1010902283 6:81442302-81442324 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1010953665 6:82066629-82066651 TTTGAGTGGGGAAATTATACAGG - Intergenic
1011637911 6:89391644-89391666 TTGGAGTGATAAAAATGTTCTGG + Intronic
1011807788 6:91092193-91092215 TTGGGGAGATGAAAATATTCTGG + Intergenic
1012106359 6:95165056-95165078 TGGGAGTGGTGAAAATTAGCTGG - Intergenic
1012403105 6:98861143-98861165 CTGGAGTGGTGAAGATATATGGG + Intergenic
1013457343 6:110342652-110342674 TTGGGGTGATGAAAGTATTCTGG - Intronic
1014003784 6:116394368-116394390 TTGGACTGCTGAATATATACAGG + Intronic
1014114780 6:117659279-117659301 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
1015279365 6:131416693-131416715 TTGGAGTGATGAAAATATTTTGG - Intergenic
1016110182 6:140213420-140213442 TTGGGGTGATAAAAATACCCTGG - Intergenic
1016112773 6:140246369-140246391 TTTGTCTGCTGAAAATATCCTGG - Intergenic
1016516710 6:144901338-144901360 TGGGAGTGATGAAAATATTTTGG - Intergenic
1016685745 6:146880415-146880437 TTGGACTGGTGATATTTTCCAGG + Intergenic
1016931949 6:149420285-149420307 ATGGGCTGGTGAAAATATCGTGG + Intergenic
1018078061 6:160233846-160233868 TTGGGGTGGTGAAAATTTTGGGG - Intronic
1018517864 6:164607341-164607363 TTGCACTGGTGAGAATATACAGG - Intergenic
1019505519 7:1388616-1388638 GTGGAGTGGGGAAGACATCCAGG - Intergenic
1019785891 7:2977174-2977196 TTGGGGTGATGAAACTGTCCTGG + Intronic
1019885850 7:3904331-3904353 TTGGAGTGGAAAAAATACTCTGG + Intronic
1020160128 7:5764252-5764274 ATGGTGTGGTGAAACTATACAGG + Intronic
1020609954 7:10383473-10383495 TTGGAGTGGAGAAAGTTGCCTGG - Intergenic
1021371341 7:19851798-19851820 TAGGCATGTTGAAAATATCCAGG - Intergenic
1021432955 7:20582409-20582431 TTGGAATGGTGAGAATGTGCTGG + Intergenic
1021504427 7:21365659-21365681 TTGCAGTGGTGAAAATATTCTGG + Intergenic
1021578243 7:22125148-22125170 TTGGAGAGGAGAAAAGATTCTGG + Intronic
1021616938 7:22511394-22511416 TTGGAATGGTGACAACATGCTGG - Intronic
1021628732 7:22622790-22622812 TTGGAGTGTTGATAATACACAGG - Intronic
1021680719 7:23128575-23128597 TTGGGGTGATAAAAATATTCTGG + Intronic
1022601986 7:31769705-31769727 TAGGGGTGATGAAAATATTCTGG - Intronic
1022727456 7:32994179-32994201 TTGGAGTGATGAAACTGTGCTGG - Intronic
1022791052 7:33689624-33689646 TTGGAGTGATGAAAAAGTTCTGG - Intergenic
1023190903 7:37581288-37581310 TTGGAGTGATGGAAATATTCTGG - Intergenic
1023284627 7:38606321-38606343 TTGGGATGATGAAAATATTCCGG - Intronic
1023611478 7:41976041-41976063 TTGGGGTGGTGAAGATATTCTGG - Intronic
1023765336 7:43505115-43505137 TTTGAGTGGAGAAAAAAGCCTGG - Intronic
1023770489 7:43552507-43552529 TTGGGGTGATGAAAATATTCTGG - Intronic
1023980242 7:45065361-45065383 TTGCAGTGGGGACAGTATCCTGG + Intronic
1024191038 7:47009946-47009968 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1025046130 7:55693470-55693492 TTGGAGTGATGAAACTGTGCTGG + Intergenic
1026022625 7:66721650-66721672 TTGAGGTGGAGAAATTATCCTGG - Intronic
1026265678 7:68794100-68794122 TTGGAGTGATGGAAATATTTTGG + Intergenic
1026429406 7:70328885-70328907 CTGGAGTGATGAAAATATTTGGG - Intronic
1026796798 7:73371159-73371181 TTGAGGTGATGAAAATATTCTGG - Intergenic
1026887027 7:73956642-73956664 TTGAGGTGGAGAAATTATCCTGG - Intergenic
1027142497 7:75668902-75668924 TTGGGGTGATGAAAATGTCCTGG - Intronic
1028140732 7:87272342-87272364 TAGGAGTGGTGAAAATAGGATGG + Intergenic
1028381541 7:90205687-90205709 TTGGTATGATGAAAATATTCTGG - Intronic
1028414051 7:90560938-90560960 TTGGCATGATGAAAATATTCTGG + Intronic
1028414074 7:90561238-90561260 TTGGGGTGCTGAAAATTTTCTGG + Intronic
1028958725 7:96724394-96724416 TTGGAGTGATGGAAATGTTCTGG - Intergenic
1030163078 7:106528234-106528256 TTGGAGCGGTGAAAATTTTTGGG + Intergenic
1033075448 7:138245933-138245955 TTGGAGTGATGAAAACATTGTGG + Intergenic
1033172875 7:139099579-139099601 TTGGGGTGATGAAAATGTTCTGG + Intronic
1033625991 7:143110050-143110072 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
1033779062 7:144647968-144647990 TTGGAATGGTGACAACATGCTGG - Intronic
1034146515 7:148878213-148878235 TTGGAATGGTGAAAAAATTCTGG - Intronic
1035576329 8:709006-709028 TTGGTGTGGTAAGAATATTCTGG + Intronic
1036281894 8:7407647-7407669 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1036339577 8:7903924-7903946 TTGGGGTGGTGAAAATTTTTGGG + Intergenic
1036417095 8:8560924-8560946 TTGAAGTGATGAAAATGTCCTGG + Intergenic
1037161255 8:15775348-15775370 TAGGGGTGATGAAAATATTCTGG + Intergenic
1037533058 8:19797225-19797247 TGGGAGTGATGAAAATGTTCTGG + Intergenic
1037955039 8:23049669-23049691 TTGGTCTGGTGATAATTTCCAGG + Intronic
1038127043 8:24686028-24686050 TTGGGGTGGAGATATTATCCTGG - Intergenic
1038369991 8:26979260-26979282 TTGGGGTGATGGAAATATTCAGG - Intergenic
1038976275 8:32700028-32700050 TTGGAATGAGGAAAATATCCTGG - Intronic
1039291950 8:36105765-36105787 TTGGAGTGATGAAAATCTTTTGG + Intergenic
1040461859 8:47657047-47657069 TTGGGATGATAAAAATATCCTGG + Intronic
1040478693 8:47804029-47804051 TTGGGGTAGTGAAAATGTTCTGG - Intronic
1041215959 8:55600436-55600458 TTGGAGTGATGAAAATAGTCAGG - Intergenic
1042349101 8:67758416-67758438 TTGGGGTGATGTAAATATTCTGG + Intergenic
1043016827 8:74949112-74949134 TTGGGGTGATGAAAATTTCCTGG + Intergenic
1044250559 8:90000533-90000555 TTGGTCTGGTGATAATTTCCAGG - Intronic
1044588303 8:93888822-93888844 TTGGAGCGGTAGAAATGTCCTGG + Intronic
1044995060 8:97830716-97830738 TTGGAGTGCTGTAAACAACCTGG + Intronic
1045217381 8:100161902-100161924 TTGGTCTGGTGATAATTTCCAGG + Intronic
1045239399 8:100385842-100385864 TTGGAGTGAAGAAAATGTTCTGG + Intronic
1045322689 8:101093884-101093906 TTGGGGTGATGAAAATGTCCTGG - Intergenic
1045533291 8:103004125-103004147 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
1045664544 8:104470610-104470632 TTGTATTGATGAAAATATCAAGG + Intergenic
1046075480 8:109306959-109306981 TTGGGGTGGTGAAAATTTTTGGG - Intronic
1046406642 8:113781139-113781161 ATGTAGTTATGAAAATATCCAGG - Intergenic
1047617904 8:126578433-126578455 GTGGAGTGGTTAGAATATCTGGG + Intergenic
1047839071 8:128728309-128728331 TTGGAGTGATGAAAATGTTTTGG - Intergenic
1047857214 8:128924308-128924330 ATGGAGTGATAAAAATGTCCTGG + Intergenic
1048098011 8:131315423-131315445 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1048144228 8:131824621-131824643 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1048227149 8:132599190-132599212 TTGGGGTGGTGTATATGTCCAGG - Intronic
1048231625 8:132647779-132647801 TTGGGGTGGTGTATATGTCCAGG - Intronic
1048464259 8:134651428-134651450 TTGGAGTAATGAAAATGTTCTGG + Intronic
1049158111 8:141079393-141079415 TTGAGGTGATGAAAATGTCCTGG - Intergenic
1050050133 9:1591164-1591186 TTGGGATGATGAAAATATTCTGG + Intergenic
1050803318 9:9642520-9642542 TTGGTCTGGTGATAATTTCCAGG + Intronic
1050836624 9:10088873-10088895 TTGGGGTGATGGAAATATTCTGG + Intronic
1051700823 9:19821899-19821921 TTGAAGTTTTGAAAATATACAGG + Intergenic
1051711303 9:19934016-19934038 TTGGGGTGATGAAAATGTTCTGG + Intergenic
1051786280 9:20747539-20747561 TTGGGGTGATGAAAATATTCTGG - Intronic
1052004866 9:23334802-23334824 TTGGAGTGATGAAAATGTTCTGG + Intergenic
1052953956 9:34237953-34237975 TTGGGGTGATGAAAATGTTCGGG - Intronic
1053257050 9:36626560-36626582 TTGGTCTGGTGATAATTTCCAGG + Intronic
1053277636 9:36795227-36795249 TTGGAGTGGTCTGAGTATCCAGG + Intergenic
1053783200 9:41631695-41631717 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
1054171153 9:61841837-61841859 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
1054666380 9:67738975-67738997 TTGGGGTGGTGAAAATTTTGGGG - Intergenic
1054735705 9:68747985-68748007 TTGGAATGGTGAAAATATCTTGG - Intronic
1054800326 9:69341699-69341721 CTGGAGTGGTCAGAATACCCAGG + Intronic
1054948437 9:70822595-70822617 TTGGAATGGTGAAAACGTTCTGG + Intronic
1055909592 9:81332959-81332981 TTGGGGTGGTAAAAATGTTCTGG + Intergenic
1055983364 9:82029412-82029434 ATGGATTGGTGAAAATAGCATGG - Intergenic
1056000847 9:82215100-82215122 TTTGAGTTATGAAAATATTCTGG + Intergenic
1056566880 9:87781004-87781026 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1057348104 9:94269704-94269726 TTGGTCTGGTGATAATTTCCAGG - Intronic
1057363622 9:94398359-94398381 TTGGCCTGGTGATAATTTCCAGG - Intronic
1057659712 9:96989728-96989750 TTGGCCTGGTGATAATTTCCAGG + Intronic
1057893748 9:98889844-98889866 TTGGAGTGATGAGACTATTCAGG - Intergenic
1057974679 9:99592407-99592429 TTGGGGTGACGAAAATATTCTGG + Intergenic
1058191847 9:101926755-101926777 TTGGGGTGATGAAAATATATTGG - Intergenic
1058457197 9:105148485-105148507 TAGGAGTCATGAAAATATTCTGG + Intergenic
1058499407 9:105595216-105595238 TTGGAGTGATTAAAATATTCTGG + Intronic
1058891873 9:109368273-109368295 TTGGAGTGATGAAAATATTCTGG - Intergenic
1058935126 9:109763139-109763161 TTGGACAGGTTAACATATCCCGG + Intronic
1060392293 9:123288256-123288278 ATGGGGTGATGAAAATATTCTGG - Intergenic
1060751948 9:126175926-126175948 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1061784700 9:133020070-133020092 TTGGAATGGTGACAACATGCTGG + Intergenic
1185492097 X:525640-525662 TTGGAGTGATAAAAATGTTCTGG + Intergenic
1185560125 X:1054296-1054318 TGGGAGTGATGAAAATGTTCTGG + Intergenic
1185792171 X:2935574-2935596 TTGGCGTGATGAAAATGTTCTGG + Intronic
1185991494 X:4896813-4896835 TTGGGGTGGTGAAAATTTTTGGG - Intergenic
1186064805 X:5751337-5751359 ATGAAATGGTGAAAATTTCCTGG + Intergenic
1186158971 X:6756466-6756488 TGGGAATGCTGAAAATATTCTGG + Intergenic
1186353961 X:8770490-8770512 TTGGAATAGAGAAAATATACAGG - Intergenic
1186359591 X:8826337-8826359 TTGGGGTGGCGAAAATATTTTGG + Intergenic
1186449962 X:9663824-9663846 TTAAAGTGCTGAAAATATACAGG + Intronic
1186470940 X:9821820-9821842 TTGGGGTGATGAAAATGTTCTGG + Intronic
1186499065 X:10036437-10036459 TTGGGGTGATGAAAATGTCTTGG - Intronic
1186512546 X:10140884-10140906 TTGGGGTGGTAAAAATGTTCTGG - Intronic
1186683451 X:11900056-11900078 TTGGATTGGTGGAGTTATCCGGG + Intergenic
1186806173 X:13142314-13142336 ATGGGGTGATGAAAATATTCTGG + Intergenic
1186817038 X:13248315-13248337 TTGGAGTGATGAAAATGCTCGGG + Intergenic
1186851771 X:13587116-13587138 TTGGGGTGATGGAAATATTCTGG + Intronic
1186853209 X:13600914-13600936 TTGGAGTGATGAAGATCTTCTGG - Intronic
1186931082 X:14390983-14391005 TTGGAATGACGAAAATATTCTGG + Intergenic
1187140523 X:16588738-16588760 TTGGAGTGATGAAAATGTTTTGG + Exonic
1187156640 X:16726116-16726138 TTGGTCTGGTGATAATTTCCAGG - Intronic
1187375595 X:18750272-18750294 TGGGAGTGATGAAAATGTTCTGG - Intronic
1187376817 X:18762995-18763017 TTGGTCTGGTGATAATTTCCAGG - Intronic
1187530699 X:20093797-20093819 TTGTGGTGATGAAAATATTCTGG + Intronic
1187717457 X:22117203-22117225 TTGGTCTGGTGATAATTTCCAGG + Intronic
1187909494 X:24097845-24097867 TTGGGGTGATGAAAATGTGCTGG - Intergenic
1188342326 X:29019262-29019284 TTGGAATGATGAAAATGTTCTGG + Intronic
1188702064 X:33277311-33277333 TTGGGGTGATGAAAATATTTTGG + Intronic
1188854794 X:35180681-35180703 TTGGAGTGATAAAAACATTCTGG - Intergenic
1189060231 X:37745941-37745963 TTGGAGTGGTGAACATGGGCAGG - Intronic
1189778024 X:44487636-44487658 TGGGAGTGATGAAAATATTCTGG + Intergenic
1189862185 X:45284466-45284488 TTGGGGTGTTGAAAATGTTCTGG - Intergenic
1189917669 X:45872716-45872738 GTGGTGTGGTGAAAAGAGCCTGG + Intergenic
1189987615 X:46568184-46568206 TTGGTCTGGTGATAATTTCCAGG - Intergenic
1190038420 X:47048722-47048744 TGGTGGTGATGAAAATATCCTGG + Intronic
1190149992 X:47937595-47937617 TTGTAGTGATGAAAATATTCTGG + Intronic
1190159785 X:48022972-48022994 TTGGGGTGGTGAAGACAGCCTGG - Intronic
1190222218 X:48519678-48519700 TTGAAGTGGCAAACATATCCAGG - Intronic
1190485208 X:50916995-50917017 TTGGGGTGGTGAAAATAGCTTGG + Intergenic
1190509588 X:51162148-51162170 GTGGAGGGGTGGGAATATCCAGG - Intergenic
1192098281 X:68236497-68236519 TTGGGGTGATGAAAATATTTTGG - Intronic
1192257543 X:69475732-69475754 TTGTAGTGATGAAAACATTCTGG + Intergenic
1192289110 X:69772979-69773001 TGGGGGTGATGAAAATATTCTGG - Intronic
1192608509 X:72544455-72544477 TTGGGGTAGTGAAAATGTACAGG + Intronic
1193463881 X:81823325-81823347 TTGGGGTGGTGAAGATGTTCTGG + Intergenic
1193714823 X:84926190-84926212 TTGGCCTGGTGAAAACATCCAGG - Intergenic
1193719657 X:84972170-84972192 TTGGGGTGATGAAAATCTTCTGG + Intergenic
1193935583 X:87615862-87615884 TGGGAGTGGTGAAAATGTTCTGG + Intronic
1194007044 X:88507576-88507598 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1194569753 X:95540696-95540718 TTGGAGTGATGAAAATATTTTGG + Intergenic
1194811286 X:98390131-98390153 ATGGAATGGTGACAATATGCTGG + Intergenic
1195164123 X:102201093-102201115 TTGGGGTGATAAAAATATTCTGG - Intergenic
1195194737 X:102486002-102486024 TTGGGGTGATAAAAATATTCTGG + Intergenic
1195290663 X:103429506-103429528 TTGGGGTGGTGAAAATTTTGGGG + Intergenic
1195511389 X:105719544-105719566 TTAGAGTGATGAAAATGTTCTGG - Intronic
1195730570 X:107963223-107963245 TTGGGGTGTTGAAAATATTTTGG - Intergenic
1195946040 X:110213208-110213230 TTGGAGTGGTGAGAAAGTTCTGG - Intronic
1196009249 X:110869474-110869496 TTGGGGTGATGAAAATATTATGG + Intergenic
1196085485 X:111679265-111679287 TTGGTTTCGTGATAATATCCAGG - Intronic
1196333967 X:114507851-114507873 TTGGAATGATGAAAATTTTCTGG + Intergenic
1196417663 X:115489315-115489337 TGGGAGTGATGAAAACATTCTGG - Intergenic
1196827363 X:119751410-119751432 TGGGGGTGTTGAAAATATTCTGG - Intergenic
1196839783 X:119848862-119848884 TTGGAGGGATGAAAACATTCTGG + Intronic
1197081246 X:122419618-122419640 TTTGAGTGATGAAAATATTTTGG - Intergenic
1197143018 X:123137634-123137656 TTAGGGTGATGAAAATGTCCTGG - Intergenic
1197171354 X:123438095-123438117 TTGAAGTGATGAAAATATTTTGG - Intronic
1197343460 X:125302599-125302621 CTAGTGTGATGAAAATATCCTGG + Intergenic
1197481478 X:126991854-126991876 TTGGTCTGGTGATAATTTCCAGG + Intergenic
1197841391 X:130751143-130751165 TTGGAGTGATGAGAATATTTGGG - Intronic
1197986692 X:132273431-132273453 TTGGAGTGATGACAATGTTCTGG - Intergenic
1199451562 X:147983012-147983034 TTGGGGTGGTTAAAATATTTTGG - Intronic
1199488271 X:148371687-148371709 TTGGAGTGGACAAGATAACCTGG + Intergenic
1199885594 X:152018629-152018651 TTGGGGTGATGAAAATGTTCTGG + Intergenic
1200120220 X:153786624-153786646 GTGGGGTGGTGAAAATGTTCTGG + Intronic
1200130731 X:153843227-153843249 TTGGGGTGATGAAAATGTTCTGG - Intergenic
1200232427 X:154450762-154450784 TTGGAGGGATGAGAATGTCCTGG - Intergenic
1200304636 X:155012037-155012059 TTGAGGTGATGAAAATATTCTGG + Intronic
1200987197 Y:9314610-9314632 TTGGAGTGGTGAAAACGTTTTGG + Intergenic
1201016805 Y:9612259-9612281 TTGGAGTGATGAAAATGTTTTGG + Intergenic
1201052894 Y:9957689-9957711 TTGGAGTGATGAAAATGTTTTGG - Intergenic
1201310317 Y:12593309-12593331 TTGGAAAGGTGAAAATGTTCTGG - Intergenic
1201552549 Y:15233957-15233979 TGGGAATGCTGAAAATATTCGGG + Intergenic
1202118393 Y:21498030-21498052 TTGGAGTGATGAAAATGTTCTGG - Intergenic
1202120845 Y:21521570-21521592 TTGGAGTGATGAAAATGTTCTGG - Intronic
1202123296 Y:21545111-21545133 TTGGAGTGATGAAAATGTTCTGG - Intronic
1202155710 Y:21884270-21884292 TTGGAGTGATGAAAATGTTCTGG + Intronic
1202158158 Y:21907811-21907833 TTGGAGTGATGAAAATGTTCTGG + Intronic
1202184611 Y:22172736-22172758 TTGGAGTGATGAAAATGTTCTGG + Intronic
1202187617 Y:22203849-22203871 TTGGAGTGATGAAAATGTTTTGG - Intergenic
1202203743 Y:22382547-22382569 TTGGAGTGATGAAAATGTTTTGG + Intronic
1202206749 Y:22413665-22413687 TTGGAGTGATGAAAATGTTCTGG - Intronic