ID: 1093941401

View in Genome Browser
Species Human (GRCh38)
Location 12:25058890-25058912
Sequence GCAAAGGTGAATGCAAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093941399_1093941401 -3 Left 1093941399 12:25058870-25058892 CCAAACATGTAAAGCAGAATGCA 0: 1
1: 0
2: 1
3: 52
4: 521
Right 1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG 0: 1
1: 0
2: 0
3: 26
4: 231
1093941398_1093941401 3 Left 1093941398 12:25058864-25058886 CCAACTCCAAACATGTAAAGCAG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG 0: 1
1: 0
2: 0
3: 26
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093941401 Original CRISPR GCAAAGGTGAATGCAAATTG TGG Intronic
901139697 1:7020679-7020701 GCAGAGGGGGCTGCAAATTGTGG + Intronic
902375648 1:16028882-16028904 GCAAAGGGGAAAACAAATGGGGG - Intronic
909051988 1:70777197-70777219 GGGCAGGTTAATGCAAATTGAGG - Intergenic
909226624 1:73032826-73032848 GAAAAGAAGAATGCAAGTTGTGG - Intergenic
909895478 1:81063849-81063871 GCAAAGGTGATCGCATTTTGTGG - Intergenic
911319392 1:96394541-96394563 GCAAAGATAAATGCAATTTGGGG + Intergenic
911727154 1:101254562-101254584 GCAAATGTTAATGAAAATGGTGG + Intergenic
912900924 1:113647413-113647435 TCAGAGGTGTATGCAATTTGAGG + Intronic
916312597 1:163413424-163413446 GCTAAGCTGAATGCATACTGCGG + Intergenic
917554784 1:176072705-176072727 GCAAATGTGGATCCAGATTGAGG - Intronic
918934740 1:190907003-190907025 GCACAGGTAAATACAAATGGTGG - Intergenic
920610319 1:207429734-207429756 GAAAAGATGAATGCAGATGGAGG + Intergenic
922968607 1:229715315-229715337 GGACAGGTTAATGCAAATTGAGG - Intergenic
923536573 1:234856977-234856999 GCAAAGATAAAGGCAAATTCTGG - Intergenic
923991237 1:239439364-239439386 GAAAATGTGAATGCAATTGGGGG + Intronic
924324302 1:242880094-242880116 ACATAGGTAAATGCAAATTATGG + Intergenic
1065932409 10:30491313-30491335 TCAAAGGTGAAGGAAACTTGGGG + Intergenic
1066560363 10:36663333-36663355 GCAAAGGAAAATGTAAAGTGGGG + Intergenic
1068055106 10:52003363-52003385 GCAAAGGAGAATGGAATTTGAGG - Intronic
1069641288 10:69957100-69957122 GCAAGGCAGAATGGAAATTGTGG - Intronic
1072327932 10:94316519-94316541 GAAAAAGTGAAGGCAAACTGAGG - Intronic
1075328325 10:121553065-121553087 GCAAGCGTGAAGGCTAATTGGGG - Intronic
1077313392 11:1903609-1903631 CTAAAGGTGAATGAAAATTACGG - Intergenic
1078481349 11:11678711-11678733 GCAAAGGTGAATCCTAGCTGAGG - Intergenic
1079004860 11:16784309-16784331 ACAATGGTGAATGGAAAGTGAGG - Intronic
1079922881 11:26453696-26453718 GCAGAGGTGAGTTCAATTTGTGG - Intronic
1082020936 11:47532586-47532608 GGAAAGGTGAATCCAATGTGTGG + Intronic
1082645892 11:55724754-55724776 GCAAAGGACATTTCAAATTGAGG + Intergenic
1082991883 11:59213591-59213613 GCTTAGGACAATGCAAATTGGGG - Intergenic
1084992452 11:72940144-72940166 GCAAAGCTGATTCCAACTTGGGG - Intronic
1085166179 11:74401771-74401793 GCAAAGGACAAAGCAAATGGAGG + Intergenic
1088847022 11:113677007-113677029 GCCATGGTGAAGGCCAATTGTGG + Intergenic
1089127515 11:116187260-116187282 GAAAAGGTGAATGCAGATATCGG - Intergenic
1089786785 11:120913256-120913278 TCAGAAGTGAATGCCAATTGTGG - Intronic
1090247348 11:125225781-125225803 GTAAAGTTGGATGCAAAATGAGG + Intronic
1093941401 12:25058890-25058912 GCAAAGGTGAATGCAAATTGTGG + Intronic
1094245928 12:28293266-28293288 GCTTAAATGAATGCAAATTGTGG + Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1095188817 12:39232536-39232558 GCATAGCTGAAGGCGAATTGAGG + Intergenic
1097766278 12:63530818-63530840 GGAGAGCTGAATGCAAATTTTGG - Intergenic
1097782714 12:63726655-63726677 GGAGAGCTGAATGCAAATTTTGG - Intergenic
1098953267 12:76663642-76663664 GCAAAGGGGCTTGCAAAATGTGG + Intergenic
1099594460 12:84642173-84642195 CCAAATGTGAATACAAATTATGG + Intergenic
1099602324 12:84756881-84756903 GCAAAGGGGAATAAAGATTGGGG - Intergenic
1101448380 12:104754687-104754709 GCAAAGGGGAATGCACATCGGGG + Intronic
1101694280 12:107109804-107109826 GCAGAGGTGACAGCAAATTGAGG + Intergenic
1103004286 12:117408948-117408970 GCAATGGTGAAGGAAAATTCTGG + Intronic
1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG + Intronic
1105747681 13:23393020-23393042 CCCAAGGTGACTGCAACTTGTGG - Intronic
1106290985 13:28361820-28361842 GAAAAGGTGAATTCAGATTAAGG + Intronic
1106596761 13:31148925-31148947 GCAATGGTAAATTCAAATTTGGG + Intronic
1107367228 13:39695324-39695346 GCAAAAATGAATGCATATTTTGG - Intronic
1107834762 13:44404465-44404487 GCAAAGGTGGAGGCAGAATGTGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109348311 13:61144689-61144711 TCAAGGATGAATGGAAATTGTGG + Intergenic
1111508886 13:89233754-89233776 GGACAGGTGAAGGCAAATTCTGG - Intergenic
1111657548 13:91173026-91173048 GGAAAAGTGAATGCAAATTAAGG + Intergenic
1111907689 13:94274205-94274227 GCAGAAGAAAATGCAAATTGTGG - Intronic
1112807017 13:103173999-103174021 GCAAAGCTGAAGGAAAATTAAGG + Intergenic
1113666398 13:112144470-112144492 GCAAAGGTGGTTGCAAGATGAGG + Intergenic
1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG + Intergenic
1116259350 14:42602982-42603004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1117079091 14:52133010-52133032 GCAAAGATGAATGTATGTTGGGG + Intergenic
1118731715 14:68671403-68671425 GCCAAGGTGAATCCACATAGGGG - Intronic
1119031047 14:71192978-71193000 GCAAAGGAGAGGGCAAGTTGAGG + Intergenic
1120241623 14:81956413-81956435 GCATAAGAGAATGCAAATGGTGG + Intergenic
1120373004 14:83662672-83662694 ACAAAACTGTATGCAAATTGAGG + Intergenic
1120401814 14:84041873-84041895 GCAAAGGTGATTTCAAATTTAGG + Intergenic
1120688877 14:87570341-87570363 GCAAAGGAGCATGCAAATAAGGG - Intergenic
1122020831 14:98836538-98836560 GCAAAGGGGAATGAAGACTGCGG - Intergenic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1125956754 15:43795671-43795693 ACAAAGGTGAGTGCCAAGTGAGG - Exonic
1127589419 15:60408834-60408856 TCAAAGCTGAAGGCAAATTCTGG + Intergenic
1128077932 15:64840079-64840101 GGAAAGATGAAGGAAAATTGAGG - Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130889725 15:88123465-88123487 TCAAAGGTTAATGCAGCTTGAGG + Intronic
1131849112 15:96518862-96518884 GGAAAGGTCAAGGAAAATTGGGG + Intergenic
1131868622 15:96738506-96738528 ACAAAGGGGAATGCAAAGTGAGG - Intergenic
1133094492 16:3432204-3432226 GCAAAGACGAAAGGAAATTGAGG + Intronic
1137393844 16:48103240-48103262 GCACAGGTGAAAGCAAGTTCAGG + Intronic
1138304815 16:55964883-55964905 GCAAAGATGAACACAAAATGGGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1141954618 16:87362170-87362192 GAAAATGTGAATGCTATTTGTGG - Intronic
1142111964 16:88337611-88337633 GCAAATGGGGATGCAAAATGAGG - Intergenic
1142255733 16:89012916-89012938 GCAGAGGTGAACGCATCTTGGGG + Intergenic
1146087973 17:29847876-29847898 GGGCAGGTTAATGCAAATTGAGG - Intronic
1153980906 18:10309721-10309743 ACAAAAGTGAATGAAAATGGTGG - Intergenic
1155003187 18:21705953-21705975 GCAAACGTGAATGCATATGCTGG + Intronic
1159217361 18:65411588-65411610 ACAAAGTTGAATCCAAAATGTGG - Intergenic
1161619253 19:5289717-5289739 CAAAAGGTGAATGGGAATTGGGG + Intronic
1162102878 19:8351060-8351082 GAAAAGGAGATTGGAAATTGCGG + Intronic
925694379 2:6560382-6560404 GAAAAGGGGAATGCAGAGTGAGG + Intergenic
925889509 2:8422126-8422148 GCAAAGGGGATTGGAAATGGAGG + Intergenic
925994900 2:9284124-9284146 GCAAAGAGGAATTGAAATTGTGG - Intronic
926130468 2:10300841-10300863 GCAAAGAAGAAAGCAAATTCAGG - Intergenic
926707950 2:15849875-15849897 GGAAAGAGGAAGGCAAATTGGGG + Intergenic
927635951 2:24817019-24817041 GCAAAGGAGAAGGGAAAATGGGG - Intronic
929986440 2:46737993-46738015 GAAAAGGTGAGAACAAATTGTGG + Intronic
930050452 2:47211625-47211647 GCAAGGCTGAATGCAGATTAGGG + Intergenic
931050254 2:58406150-58406172 GAAAAGGTAATGGCAAATTGTGG + Intergenic
931202593 2:60113399-60113421 GGAAAGATGAATGCAAAGTGAGG - Intergenic
931669622 2:64635839-64635861 GCAAGGGTGCATGCACAGTGTGG + Exonic
931965433 2:67528671-67528693 GTGCAGGTTAATGCAAATTGAGG - Intergenic
932682360 2:73836789-73836811 GCAGAGGTGCATGCACACTGGGG + Intronic
932748645 2:74356562-74356584 AAACAGGTGAATGCAAATTGTGG + Intronic
934976763 2:98808386-98808408 GCAAAGCTGGCTGCAACTTGCGG - Intronic
935549625 2:104438804-104438826 GGAAAGGTGAATGCAATTAATGG - Intergenic
935920030 2:108002566-108002588 GCAAAGGTGCAGGCACTTTGAGG + Intronic
939367790 2:141257201-141257223 ACAAAGGTGAATGTAATTAGGGG + Intronic
939499650 2:142967319-142967341 TAAAAGTTGAATGCAAATGGTGG + Intronic
939533034 2:143389565-143389587 TCAAAGGAAAATGCAAATTGAGG + Intronic
940660831 2:156543220-156543242 CCATAGTTGAATGGAAATTGAGG + Intronic
940816103 2:158299407-158299429 GCAAAGGCAAATACAATTTGGGG - Intronic
943798280 2:192026098-192026120 GCAAAAGTGAAAGCCACTTGGGG - Intronic
1170350961 20:15440459-15440481 GCAAACTTGAATGCAAATGAGGG - Intronic
1172455394 20:35068160-35068182 GCAAAAGTGAATGTATTTTGTGG + Intronic
1173308103 20:41871170-41871192 GAACAGGTCAATGCAAATTGAGG - Intergenic
1174836118 20:53856631-53856653 GCAAAGGTGGTTTCAAAGTGTGG + Intergenic
1175375892 20:58523801-58523823 GCCAAGGTAAATGCAAGTTGGGG + Intergenic
1177530864 21:22356001-22356023 GCAAAGCTGATTGGAAGTTGGGG + Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1181361217 22:22338406-22338428 GCAAAGATGAGTAGAAATTGTGG + Intergenic
1182987752 22:34736945-34736967 GCAAGGGTGTCTGCAAATTAGGG - Intergenic
949845803 3:8369489-8369511 GTAAAGTTGGATGAAAATTGAGG + Intergenic
950266817 3:11579719-11579741 GGAAAGGTGCATGAAACTTGGGG - Intronic
951552337 3:23886494-23886516 GCAGAGGAGAATACAAGTTGGGG - Intronic
954720298 3:52555987-52556009 CCAAAGGTGACTGCATTTTGGGG - Intronic
955842693 3:63129056-63129078 GCAAAGGAGAATTAAAGTTGCGG + Intergenic
956321154 3:67998348-67998370 GAAAAGGAGAATGAATATTGAGG - Intergenic
957119274 3:76068754-76068776 GAAAAGGAGAAGGCAGATTGGGG - Intronic
958262397 3:91396932-91396954 TCAAAGGTGAAAGAAAAATGTGG + Intergenic
958492267 3:94792406-94792428 GAAAAGGGTAATGCAAATGGTGG - Intergenic
959395029 3:105826577-105826599 GAAAGGGTGAATGGAAGTTGGGG - Intronic
959960675 3:112294529-112294551 GAAAAAGTGAATGGATATTGTGG + Intergenic
960016001 3:112888879-112888901 AAAAAGGTGCATGCAAATTCTGG - Intergenic
960315026 3:116166020-116166042 GCAATAGAGAATGCTAATTGTGG + Intronic
962153538 3:132918890-132918912 GTAAATGTAAATGTAAATTGAGG - Intergenic
962564257 3:136641129-136641151 ACAAAGTTGAATGAAAATTGGGG + Intronic
963559834 3:146850025-146850047 GAAAAGGTGTGTGCAAATTTTGG + Intergenic
964063472 3:152553875-152553897 GCAAAGTCCAAGGCAAATTGGGG - Intergenic
964996252 3:162885196-162885218 GTAAAGGAGAGGGCAAATTGTGG + Intergenic
965196365 3:165601552-165601574 GTAACGATGAATACAAATTGGGG + Intergenic
965478363 3:169185494-169185516 TAAAAAGTGAATGGAAATTGAGG + Intronic
966645695 3:182244480-182244502 ACAAGGGTCAATGCTAATTGGGG - Intergenic
966678778 3:182618403-182618425 GCAAAAATGAAGGCAAAATGTGG - Intergenic
967134981 3:186505490-186505512 GAAAAGGTGCACACAAATTGAGG - Intergenic
967900316 3:194443394-194443416 GAAAATGTGTATGTAAATTGGGG + Intronic
971980895 4:33748358-33748380 GCAAAAGTGAAAGCAAATATAGG - Intergenic
972193582 4:36625773-36625795 GCAAAAGAGAATGTATATTGGGG + Intergenic
974679579 4:65144013-65144035 GCAAAGGTCATGGCAAATTTTGG - Intergenic
975042094 4:69758645-69758667 GCAAAAGTGAATGAATATTGAGG + Intronic
976080478 4:81349284-81349306 TCAAAGGGCAAGGCAAATTGTGG - Intergenic
976262162 4:83155969-83155991 GCAAAGGTGGTTTCAAATTTGGG - Intergenic
976483611 4:85573874-85573896 GCAAAGGTAAAGGAAAGTTGAGG - Intronic
976577891 4:86697348-86697370 GGAAAGATGTATGCAAATTTGGG + Intronic
977007436 4:91587231-91587253 GCTAAGGTGAATCCAAATGATGG - Intronic
978832479 4:113105071-113105093 GCAAAGCTGAATAGAAATTCAGG + Intronic
980340170 4:131534326-131534348 TTAAAGGTTAATTCAAATTGTGG - Intergenic
980663316 4:135895965-135895987 TCATGGGTGAATGCAAATTTAGG + Intergenic
981974555 4:150709925-150709947 GCAAAGGTAAATGGAGAATGAGG + Intronic
982611882 4:157584703-157584725 ACAAAGATGAATTCAAAATGTGG - Intergenic
982625613 4:157762255-157762277 GGAAAGCTGAATGCAAATTTGGG - Intergenic
982959059 4:161812687-161812709 CCAAAGGTGAATGCCAGTTTAGG + Intronic
983152234 4:164298819-164298841 ACAAAGGTTGATGCAAAGTGAGG + Intronic
984378262 4:178958966-178958988 GCAAAAGTGAAAGAGAATTGAGG + Intergenic
984934622 4:184879462-184879484 GCTTAGGTGATTGCAGATTGTGG + Intergenic
984937690 4:184903656-184903678 GCAAAGGTGAATGCAAGTATTGG - Intergenic
985136653 4:186792982-186793004 GGGCAGGTTAATGCAAATTGAGG + Intergenic
985700465 5:1368840-1368862 GGACAGGTCAATGCAAATTAAGG - Intergenic
985701433 5:1375487-1375509 GTAGAGATCAATGCAAATTGAGG - Intergenic
986298841 5:6462345-6462367 GGAAAGCTGAATGCAAATCTGGG - Intronic
987433112 5:17860849-17860871 GCAAATGTTAATGCAAACAGAGG + Intergenic
993382363 5:87222392-87222414 GCAAAGGAGAATTAAAGTTGTGG + Intergenic
993438063 5:87922494-87922516 GCAGAGGTGAGTTCAAATTCTGG + Intergenic
994513527 5:100740056-100740078 ACCAATGTGAATGCAAACTGTGG - Intergenic
994772554 5:104002011-104002033 GCACATGTTACTGCAAATTGAGG + Intergenic
994842110 5:104937909-104937931 GGAAATATTAATGCAAATTGAGG - Intergenic
995908655 5:117158472-117158494 GCAAAGGTGATTCTAAATTCAGG - Intergenic
997005484 5:129812010-129812032 AAAAAGGCGAATGGAAATTGAGG - Intergenic
997449930 5:133974436-133974458 GAAAAGGAGAATGAAAAGTGAGG + Intronic
998914431 5:146998523-146998545 GCAAATGTGCATGCAAATACAGG - Intronic
1000662034 5:163949289-163949311 TAAAAGGTGAATGCCAAGTGAGG + Intergenic
1003456479 6:6287457-6287479 GCAAGGGTGAAGGCAAATTAGGG + Intronic
1004231744 6:13839975-13839997 ACAATTGTGAATGCAAATTTGGG + Intergenic
1004269678 6:14183569-14183591 TCATAGGTGACTGCAGATTGAGG + Intergenic
1004593903 6:17080535-17080557 GCAAGGATGGATGCAAAGTGGGG + Intergenic
1005414944 6:25589831-25589853 TTAAAGGTGAATGCAACCTGTGG - Intronic
1005902931 6:30234704-30234726 GAAAAAGTGCATGAAAATTGGGG - Intergenic
1005915373 6:30346301-30346323 TCAAATGTGCATTCAAATTGGGG + Intronic
1006861237 6:37172607-37172629 GCAGTGGTGAATGCAATTTAAGG + Intronic
1007711353 6:43826232-43826254 AGAAAGGGGAATGCAAGTTGGGG - Intergenic
1008068292 6:47073865-47073887 GGAAAGGTAAGTGCAATTTGGGG + Intergenic
1008391943 6:50962456-50962478 GCAATGGAGAATGTAAAGTGGGG + Intergenic
1008993020 6:57625945-57625967 TCAAAGGTGAAAGAAAAATGTGG - Intronic
1009181634 6:60525050-60525072 TCAAAGGTGAAAGAAAACTGTGG - Intergenic
1010362861 6:75014918-75014940 GCAAAGGTGAATTCAATTCCTGG - Intergenic
1010640104 6:78314965-78314987 CCAAAAGTGAATGCAAAGTCAGG + Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1013272263 6:108556233-108556255 GCAAAGGTCGAGGCAATTTGTGG + Intergenic
1018069945 6:160155512-160155534 GCACAGGTGAATACAAAAAGAGG + Intronic
1018623260 6:165751802-165751824 GGACAGGTGCATGCAAATTGAGG - Intronic
1019315697 7:384953-384975 GAAAAGGTAAATGCAGACTGAGG + Intergenic
1019904459 7:4050258-4050280 AGTAAGTTGAATGCAAATTGTGG - Intronic
1020581801 7:10011883-10011905 GCAATGGAGAAGGCAAAATGTGG + Intergenic
1021521069 7:21539523-21539545 GAAAAGGTGAATGGACACTGGGG + Intergenic
1021652263 7:22843813-22843835 GCAAAGGTGAATGTCAACTGAGG - Intergenic
1022681672 7:32553861-32553883 GCTAAATTGAATGCAGATTGTGG + Intronic
1023250405 7:38254202-38254224 GCAAAGTGGAATGCAAACAGAGG - Intergenic
1023251708 7:38270306-38270328 GCAAAGTGGAATGCAAACAGAGG - Intergenic
1023759829 7:43454862-43454884 GCAAAAGTGACTGCAAAAGGAGG - Intronic
1024344804 7:48302269-48302291 GCAGAGATCAATGCCAATTGGGG - Intronic
1026452588 7:70542509-70542531 GCCAGGGAGAATGCAAAGTGGGG + Intronic
1030041882 7:105458886-105458908 CCAAAGGTGAGTGAAAATTCAGG - Intronic
1030416401 7:109249277-109249299 GAAAGGGTGAATGCAACATGAGG - Intergenic
1030480123 7:110092772-110092794 GCAGAAGTGACTGCAATTTGGGG + Intergenic
1030750823 7:113229818-113229840 GCAAAAGTGAATACAATGTGTGG - Intergenic
1032467434 7:132154972-132154994 GCAGAGGAAAATGCAAACTGGGG + Intronic
1033140085 7:138818069-138818091 GCAAAGGTGAACCCAAATTCTGG + Intronic
1034848914 7:154475402-154475424 ACAAAGGGGAATGAAGATTGTGG - Intronic
1035741916 8:1935154-1935176 GCAAAATTGAATGAAAAGTGCGG + Intronic
1038231577 8:25705459-25705481 GCAAAAGTGAAGGCAGATTTAGG + Intergenic
1040561539 8:48527266-48527288 GCAATGGTGAATTCAAATCCAGG - Intergenic
1042237921 8:66633718-66633740 GAAAAGTTGATTGCAAAGTGTGG - Exonic
1042648221 8:71010659-71010681 GCCAAGGGGATTGCAAAGTGGGG + Intergenic
1043378552 8:79677948-79677970 GCAGAGGTATATGCAATTTGGGG + Intergenic
1044030946 8:87236479-87236501 GCAAAGATAAATGAAAATTAAGG + Intronic
1044269685 8:90227097-90227119 GCAAAGATGAATATATATTGAGG + Intergenic
1047303171 8:123632473-123632495 GTAAACGTGAAAGCAGATTGTGG - Intergenic
1052181747 9:25537202-25537224 GCAAATGTGAATTCAAACTCAGG + Intergenic
1052195079 9:25702312-25702334 GGAGAGGGGAATGTAAATTGTGG - Intergenic
1052464691 9:28815520-28815542 GCAAACATGTATGCAGATTGAGG - Intergenic
1054954641 9:70894646-70894668 GCAAAAGTGAATGCAAGATTTGG + Intronic
1055023913 9:71699060-71699082 GCAAAAGTAATTGCGAATTGCGG - Intronic
1056590326 9:87961731-87961753 TCAAAGGTTAAGTCAAATTGTGG + Intergenic
1057251552 9:93507478-93507500 GCACAGGTGAAAGCAGAGTGAGG + Intronic
1057570356 9:96199620-96199642 GAAAAGCTGAAAGAAAATTGAGG + Intergenic
1057923601 9:99121605-99121627 GCAAAGGTGAAGGCAAAAGTTGG - Intronic
1058005868 9:99913700-99913722 GCAACAGTGAATGGAAACTGGGG - Intronic
1058027135 9:100154022-100154044 TCAAAGGTAAATGCATATTCTGG - Intronic
1058562602 9:106245810-106245832 GCAAAGGTGAATTAAGGTTGAGG - Intergenic
1061812805 9:133172214-133172236 GCAAAGGGAAATGCAAATCGTGG + Intergenic
1062074353 9:134576425-134576447 AGAAAGGTAAATGCAATTTGAGG + Intergenic
1186071845 X:5829569-5829591 GCACAGATGATTGCAGATTGGGG - Intergenic
1186240789 X:7563585-7563607 TTAAAGGTGAAAGCAAATAGAGG + Intergenic
1186299601 X:8185415-8185437 GCAAGGGTGAATGCAGAATGAGG + Intergenic
1188258911 X:27999385-27999407 GCAAAGGTGAAGGGACTTTGTGG + Intergenic
1188325330 X:28795450-28795472 GCACAGATGAATACCAATTGTGG + Intronic
1188381206 X:29494871-29494893 GCAAAATTAAATGGAAATTGAGG - Intronic
1188589433 X:31815680-31815702 TCAAAGGGGTATGCATATTGGGG - Intronic
1189463089 X:41258397-41258419 GCCAAGATGAATGCTAAATGTGG - Intergenic
1189546168 X:42044894-42044916 TCAGAGGTGAAGGCAAATCGTGG - Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190574300 X:51817519-51817541 TCAGAGGTGAAGGCAAACTGAGG - Intronic
1195389221 X:104343689-104343711 GGGCAGGTTAATGCAAATTGAGG + Intergenic
1196032150 X:111102531-111102553 GAAAAGGGGAATGGAAATGGAGG + Intronic
1198314143 X:135449966-135449988 GCCATGGGGAATGCAAATGGTGG - Intergenic
1201617346 Y:15915439-15915461 GCAAATATGAATGCAAAATGAGG - Intergenic