ID: 1093943684

View in Genome Browser
Species Human (GRCh38)
Location 12:25083710-25083732
Sequence CAATAAATTAAGGTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093943684_1093943687 24 Left 1093943684 12:25083710-25083732 CCTAGCTCCACCTTAATTTATTG 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1093943687 12:25083757-25083779 TTTATTCATCAAAAGTCAATTGG 0: 1
1: 0
2: 2
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093943684 Original CRISPR CAATAAATTAAGGTGGAGCT AGG (reversed) Intronic
903411973 1:23152107-23152129 CAATAAATTGTGGTTCAGCTTGG - Intronic
906630269 1:47361403-47361425 AAATAAAATAAGGTGGAATTTGG + Intronic
907579174 1:55556386-55556408 AAATAAAATAAGATGGAGCCTGG - Intergenic
908095326 1:60731484-60731506 CCATAAATCAAGGTGTAGCTGGG - Intergenic
908940703 1:69430200-69430222 AGATAAATTAAGATAGAGCTAGG + Intergenic
911228692 1:95336521-95336543 CAATAAGTTATGTTGTAGCTGGG + Intergenic
911249679 1:95560521-95560543 CATTATATGAAGGTGGAGCAAGG - Intergenic
912986999 1:114443736-114443758 AAAAATATTAAGGTGGAGCCAGG + Intronic
913667707 1:121064297-121064319 TAATAAATTAAGGATTAGCTGGG - Intergenic
914003307 1:143710874-143710896 CATTAAAATAAGGTGGAAATTGG - Intergenic
914019399 1:143851429-143851451 TAATAAATTAAGGATTAGCTGGG - Intergenic
914657948 1:149759642-149759664 TAATAAATTAAGGATTAGCTGGG - Intergenic
915074746 1:153298887-153298909 ATATAAAGCAAGGTGGAGCTGGG + Intronic
919057524 1:192589562-192589584 CAGTAAATCAAGGTTGAGCAAGG + Intergenic
919930396 1:202217532-202217554 CAATTCATTCAGGTGGGGCTGGG - Intronic
920272896 1:204780078-204780100 CAATGAGATAAGGTGGGGCTAGG + Intergenic
920525195 1:206661044-206661066 TAAGAAATCAAGGTGGAACTGGG + Intronic
920663150 1:207935794-207935816 GAATAAATCAAGGTGGAAATTGG - Intergenic
920743927 1:208607559-208607581 AAATAAATTATGGTGGTGCCAGG - Intergenic
923099380 1:230800324-230800346 TGATAAATAAAGGTGGACCTAGG - Intronic
923165269 1:231355610-231355632 CTCTTAATTAAGGTGGGGCTTGG + Intergenic
1070207248 10:74276054-74276076 CATTAAAATAAGGTGGAATTTGG - Intronic
1070787740 10:79171771-79171793 CAAGAATTTCAGGTGGGGCTAGG + Intronic
1071866558 10:89740818-89740840 CAATAAATTTAAAAGGAGCTAGG - Intronic
1074485321 10:113871463-113871485 CAATAAATTGAGGTGGGGCGTGG - Intronic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1078160759 11:8837769-8837791 CAATCAATAAATGTAGAGCTTGG + Intronic
1078974815 11:16461504-16461526 CAATAAGTTCAGGTGGATTTAGG - Intronic
1082803911 11:57434686-57434708 GAAAATATCAAGGTGGAGCTTGG + Intergenic
1083094484 11:60235562-60235584 CAAAAAAGTAAGGTGGTGCAAGG - Intronic
1085986376 11:81793022-81793044 GAATAAATAAAGGTGGCTCTTGG - Intergenic
1086171988 11:83846815-83846837 AAACAAATTGAGGTGGAACTTGG - Intronic
1087037080 11:93766543-93766565 CATTAAAATAAGGTGGAACTTGG + Intronic
1088701370 11:112415492-112415514 CAATCAATTAATGTGAAGGTAGG + Intergenic
1091182095 11:133614579-133614601 TAATAAATAAAAATGGAGCTGGG + Intergenic
1091230343 11:133984136-133984158 CAACTAAATAAGGTGCAGCTGGG + Intergenic
1091641067 12:2237900-2237922 ACGTAAATAAAGGTGGAGCTAGG - Intronic
1093052425 12:14518575-14518597 CAATAAAACAAGGAGGAGGTGGG - Intronic
1093103354 12:15054793-15054815 CATTAAAATAAGGTGGAATTTGG + Intergenic
1093943684 12:25083710-25083732 CAATAAATTAAGGTGGAGCTAGG - Intronic
1094011855 12:25817928-25817950 GCATCCATTAAGGTGGAGCTTGG + Intergenic
1095721519 12:45406322-45406344 CAAAACACTAAGGTGGAGCTGGG - Intronic
1097531367 12:60804550-60804572 CAATAAAATAAGATGGGGCAAGG - Intergenic
1098213098 12:68186802-68186824 CAATTAGTGAAGATGGAGCTAGG - Intergenic
1099102179 12:78456453-78456475 AAATAAGTTAAGGTAGAGGTAGG - Intergenic
1100126299 12:91430556-91430578 AAATAAAATAAAATGGAGCTTGG - Intergenic
1103780373 12:123394851-123394873 CAAAAAATCGAGCTGGAGCTAGG + Intronic
1106108199 13:26753148-26753170 CAATATATCAATGTTGAGCTGGG + Intergenic
1111674360 13:91368592-91368614 CTCTAAATTAAGGGAGAGCTGGG + Intergenic
1112772017 13:102801943-102801965 CCAAAAAGTAATGTGGAGCTTGG + Intronic
1114458812 14:22873936-22873958 CAGTGAATTGAGGTGGAGCTGGG + Intronic
1116552619 14:46261191-46261213 GGATAAACTAATGTGGAGCTAGG - Intergenic
1116603365 14:46957396-46957418 TCATAAATGAAGCTGGAGCTGGG - Exonic
1122050526 14:99056507-99056529 CAATAGGTTAAGGTGAAGGTTGG - Intergenic
1125310339 15:38372249-38372271 AAATAAACTAAGGGGGAGCAAGG - Intergenic
1127817342 15:62622824-62622846 TAATAAAATAAGATGGAGTTTGG + Intronic
1131899365 15:97070992-97071014 CAATACATTAATGTGGAACATGG + Intergenic
1135020513 16:18959015-18959037 CAATAAAATGAGGTGGAATTTGG - Intergenic
1136046046 16:27615796-27615818 CATTAAGTTAAGGTGGTCCTGGG + Intronic
1137324461 16:47420070-47420092 CAATAAATTAAGGCAGGGCATGG - Intronic
1140731245 16:77858705-77858727 CAGTAAAATAAGGTGACGCTGGG + Intronic
1143879099 17:10016093-10016115 CAATAAGTTAAGGTCGGGCACGG + Intronic
1147370064 17:39986389-39986411 AAAGAAATCAAGGAGGAGCTGGG - Intronic
1151288330 17:73129776-73129798 TAATAAATTAAGGTGAGGCCGGG - Intergenic
1153597680 18:6744644-6744666 CAATTACTCAAAGTGGAGCTTGG + Intronic
1156719774 18:40056021-40056043 TAAAAAATTAATATGGAGCTTGG - Intergenic
1158254189 18:55527077-55527099 CAATAAAGAAAGGAGGAGATAGG + Intronic
1162695573 19:12471298-12471320 AATTAAATTAAGGTGGAAGTTGG + Intronic
933469951 2:82709627-82709649 AAATAAGTTAAGGTGTAGCTGGG - Intergenic
937205849 2:120236752-120236774 AAATCAATTAATGTGGGGCTTGG + Intergenic
937846547 2:126584961-126584983 CAACAAGTGGAGGTGGAGCTGGG - Intergenic
938067721 2:128291147-128291169 CAATAAAACAAGGAGGAACTAGG + Intronic
938113494 2:128587572-128587594 CAGTAAATTCAGGAGGAGCCTGG - Intergenic
939426603 2:142046466-142046488 CAACAAATTAGGCTGCAGCTTGG + Intronic
941013747 2:160331271-160331293 CAGGAAATTAAGGTGGAGCAGGG - Intronic
941201309 2:162513656-162513678 TAATAATGTAAGTTGGAGCTAGG - Intronic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
947246125 2:228050793-228050815 AAATAAATAAAGGTGGAGTGGGG - Intronic
947320080 2:228907675-228907697 AAATAAATTATGGTGGGGCCGGG + Intronic
947458966 2:230285903-230285925 TAAACAATTAAGGTGGATCTAGG - Intronic
1169050530 20:2573207-2573229 CAATACACTATGGTGGAACTTGG - Intronic
1169970479 20:11264693-11264715 TAATAAATTAAAGGGGTGCTGGG + Intergenic
1172470451 20:35189922-35189944 CAGTAAAGTAAGGTGCAGATTGG - Intergenic
1173720074 20:45250314-45250336 CAAAAAATTAAGGAGGAGAAAGG + Intergenic
1175655286 20:60764746-60764768 CAATAAATTATGGTAGCCCTTGG + Intergenic
1177174702 21:17691052-17691074 AAATAAATTAAGGAGCAGCAGGG - Intergenic
1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG + Intergenic
951352979 3:21629290-21629312 CTATAATTTCAGGTGGAGGTTGG + Intronic
951437311 3:22679675-22679697 CAATAAACTGAGGTGGGGCATGG + Intergenic
952056461 3:29452828-29452850 GAATAAGTTAAGGTAAAGCTGGG + Intronic
952291770 3:32023596-32023618 CAACAAATTGAGATGGAGCAGGG - Intronic
957258650 3:77871769-77871791 CAATAATTTAAGATGGAGACAGG + Intergenic
957798545 3:85044097-85044119 CAATAAGCTAAGGTGAAGCAAGG - Intronic
958632671 3:96702196-96702218 AAACAAATTAAGGGGGACCTTGG + Intergenic
959445979 3:106440127-106440149 CAAGAGATTAAGGTGGAACATGG + Intergenic
960451169 3:117809952-117809974 CATGAAATGAGGGTGGAGCTGGG + Intergenic
964369502 3:155985156-155985178 CAATAAACTAGGGAGGAACTTGG - Intergenic
965734426 3:171805607-171805629 AACGAAATTAAGGTGGAGCATGG - Intronic
965874958 3:173305606-173305628 AAAAAAATGAAGGTGGAGCCAGG - Intergenic
967168044 3:186801729-186801751 AAAGAAATTAAAGTGGGGCTGGG + Intronic
968780208 4:2574692-2574714 CCTTAAATAAATGTGGAGCTGGG + Intronic
971024542 4:22575748-22575770 CAGTGAATTGAGGTTGAGCTTGG + Intergenic
971870229 4:32226191-32226213 CAAGAAATTAAGCTGCAACTTGG + Intergenic
973738735 4:53899251-53899273 CTATAAATTAATGTTGGGCTGGG + Intronic
975543254 4:75535916-75535938 CAATCAATAGAAGTGGAGCTAGG - Intronic
976594548 4:86882710-86882732 CATTAAAATAAGGTGGAGTTTGG - Intronic
977723960 4:100272354-100272376 CAAAAAAAAAAGGTAGAGCTGGG + Intergenic
977732934 4:100377267-100377289 CATCAAATTTAGGTGAAGCTTGG + Intergenic
979863625 4:125725196-125725218 CAATAAATTAAGTTAGAGAAAGG + Intergenic
981931194 4:150190963-150190985 AAATAAATTAAGATTTAGCTAGG + Intronic
982036973 4:151355309-151355331 CACTAATTTCAGGAGGAGCTGGG + Intergenic
982052779 4:151518966-151518988 CAAAAAATTAAGATGCAGCTAGG - Intronic
982743969 4:159087102-159087124 AAATAAATAAAGGTGGAATTGGG + Intergenic
982940160 4:161540490-161540512 AAATAAATCAAGGTGAAACTAGG - Intronic
986025296 5:3844932-3844954 AACTCCATTAAGGTGGAGCTAGG + Intergenic
986450951 5:7864571-7864593 AAATAAATTAAGGTGTAGAAAGG + Intronic
986681924 5:10241211-10241233 CTATAAATTAAGAGGGAGCCAGG - Intronic
987685344 5:21192018-21192040 CAATATATAAAGGTGCAGTTTGG - Intergenic
993133991 5:83933781-83933803 CAATAAATTTATGTGGAGTTGGG - Intergenic
995174979 5:109165795-109165817 TATTAAAGTAAGGTGGAACTTGG + Intronic
997021038 5:130002079-130002101 CTATAAACAAAGGTGGTGCTTGG + Intronic
1001748992 5:174113818-174113840 GAATAAATAAATGTGGAGATGGG - Intronic
1005590649 6:27322521-27322543 CTATAAAATAAGGAGCAGCTGGG - Intergenic
1009640571 6:66330625-66330647 CAAAAAATTCAGTTGAAGCTGGG - Intergenic
1009725340 6:67530807-67530829 AAACAAATTAAGGGGGATCTTGG - Intergenic
1010134684 6:72537260-72537282 CAATAAAGTCAGCTGGACCTGGG + Intergenic
1011695105 6:89905361-89905383 TAACAAATTAAGGCCGAGCTCGG - Intergenic
1013083605 6:106834968-106834990 CAATAAATGACGTTGCAGCTGGG - Intergenic
1015036206 6:128657814-128657836 AAAGAAATTAAGCTTGAGCTAGG + Intergenic
1015275853 6:131382903-131382925 CTACAAATTACTGTGGAGCTGGG + Intergenic
1016787952 6:148034010-148034032 CCAGAGATTAAGGTGGAGCAGGG + Intergenic
1017150126 6:151271953-151271975 CATTAAATTAACGTTGGGCTGGG - Intronic
1017596267 6:156031798-156031820 CAATAAATTGAGAGGGAGATTGG + Intergenic
1017728066 6:157289695-157289717 GAAGAAATTAAGGTGGGGGTGGG - Exonic
1018519111 6:164624856-164624878 GAAAAAATTAAGGTGGAGTATGG + Intergenic
1020577193 7:9947875-9947897 GAATAAATTAAGATGGAGGATGG - Intergenic
1024794065 7:53002401-53002423 CAATAAATTATGGCGGATTTTGG + Intergenic
1026140128 7:67698636-67698658 CATTAAAATGAGGTGGAGTTGGG + Intergenic
1026428006 7:70315833-70315855 CAATAATCTAAGCTGGAGGTAGG - Intronic
1028022655 7:85795844-85795866 CAAAAAATTAAGGAGGACATAGG + Intergenic
1028514716 7:91664433-91664455 CATTAAATTAAGGAGGAAGTGGG + Intergenic
1029526424 7:101097271-101097293 CCATAAATTAAGTGGGAGATTGG + Intergenic
1031507404 7:122602880-122602902 TATGAAATTAAGGTGAAGCTGGG - Intronic
1032065949 7:128770844-128770866 TAATACATTCAGGTGGTGCTGGG + Exonic
1032957885 7:136993627-136993649 CACTAAAATAAGCTCGAGCTAGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1036172608 8:6503857-6503879 CCAGAAATTAAGGTGCAGATGGG - Intronic
1036539041 8:9685644-9685666 TAATTAATTCAGTTGGAGCTTGG + Intronic
1037588988 8:20297383-20297405 CAATAAAGTAGGATGTAGCTAGG - Intronic
1038835675 8:31119389-31119411 CAAAAAATTAAGTAGGAGCCAGG - Intronic
1038858517 8:31359873-31359895 CAATAAAATGAGGTGGAATTTGG - Intergenic
1039827179 8:41184574-41184596 CAATAGATGAATGTGCAGCTGGG + Intergenic
1040560370 8:48518288-48518310 CAAGAAATTAAGGTGCAGAGGGG - Intergenic
1041906390 8:63038203-63038225 CAAGAAATTAAGGTATAACTTGG - Intronic
1041978396 8:63826322-63826344 CAATAACTTAACGTGCAACTGGG + Intergenic
1043859981 8:85304782-85304804 CATGAAATTAAGGTGGAGAGTGG + Intergenic
1045765301 8:105660714-105660736 CAATACTTTAATGTGGAGCTAGG - Intronic
1047231864 8:123004467-123004489 CAATAAATGAAAGGAGAGCTGGG + Intergenic
1047685912 8:127304541-127304563 AAATTAATCAAGTTGGAGCTGGG - Intergenic
1048110489 8:131462522-131462544 CAATAAAGTGTGGTGGAACTGGG + Intergenic
1049994120 9:1018433-1018455 CAAGAAATTTAGGTAGAGCATGG + Intergenic
1051906372 9:22099406-22099428 CAATGAATTGACGGGGAGCTGGG + Intergenic
1052933369 9:34073782-34073804 CAATAAATTGAGGTGGGGTGCGG - Intergenic
1056195552 9:84225101-84225123 CAAGAAATTGAGATGGAGCAGGG - Intergenic
1057287884 9:93775026-93775048 CAATATATTAATTTGGAGCGGGG - Intergenic
1059027746 9:110654584-110654606 CAAGAAAATAAGGTGGGGCAAGG - Intergenic
1061177265 9:129005269-129005291 CAAGAAATGAAGGTGGAGCTTGG - Intronic
1061426369 9:130500892-130500914 CAATTAATTCAGGCAGAGCTGGG - Intronic
1061977959 9:134081793-134081815 CAAAAAATGAAGTTGAAGCTGGG + Intergenic
1186188384 X:7043779-7043801 CAAGAAATTAAAGTGGAGAAAGG + Intergenic
1188902771 X:35754347-35754369 CAATAACATAAAGTGGGGCTGGG + Intergenic
1188944980 X:36289512-36289534 CAAAAAATGAAGATGTAGCTAGG + Intronic
1188947051 X:36318020-36318042 GAATAAATGAATGTGGACCTGGG - Intronic
1193221420 X:78930874-78930896 CTATAATTTAAGGTGGCACTAGG + Intergenic
1196520792 X:116668327-116668349 AAGTAAATTAAGGGGGATCTTGG + Intergenic
1198084752 X:133271444-133271466 AAGTAAATTAAGATGGAGATTGG + Intergenic
1200403518 Y:2784394-2784416 AAATACATTAAGAGGGAGCTTGG - Intergenic