ID: 1093953194

View in Genome Browser
Species Human (GRCh38)
Location 12:25187721-25187743
Sequence CCTTGGGGACCTTTTTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093953194 Original CRISPR CCTTGGGGACCTTTTTGTTT TGG (reversed) Intronic
900519094 1:3097047-3097069 CCTGGGGGACCCTTTTGCTGGGG + Intronic
902196176 1:14800130-14800152 CCTTGGGGTACTTTTGGGTTAGG - Intronic
903192638 1:21665567-21665589 CCAGTGGGACCTTTCTGTTTTGG + Intronic
903261607 1:22134489-22134511 CCTTGGAGACCCTTGTCTTTTGG + Intronic
903299991 1:22371957-22371979 CCTTGGTGGGCTTTTTGGTTTGG - Intergenic
906474316 1:46157792-46157814 CCCTGGGCACCTTCTTGTTTTGG - Intronic
906480061 1:46193901-46193923 CATTGAGGACCTTGTTGTCTGGG + Exonic
907625476 1:56025139-56025161 TCCTGTGGACCTTTTAGTTTGGG - Intergenic
911621683 1:100072735-100072757 CCTTTGGAACCTTTTCTTTTTGG + Intronic
911663677 1:100531406-100531428 CCTTGGGAACCTTTATATGTGGG - Intergenic
911701175 1:100953383-100953405 TCTTGCTGACCTTTTTGTTCTGG + Intronic
916736199 1:167608855-167608877 CCTTGGGGAGCTTTTACTTATGG - Intergenic
918210882 1:182349811-182349833 CCTTTGGTTCCTTTTTGTTTGGG + Intergenic
918269920 1:182888336-182888358 TCTTGGGCATATTTTTGTTTTGG + Intergenic
921259572 1:213373896-213373918 CCTTGGGAAGCTTCTGGTTTCGG - Intergenic
1063850303 10:10181878-10181900 GCCTGGGGACCATTCTGTTTTGG + Intergenic
1067487787 10:46668070-46668092 CCTTAGGGTCCTCTTGGTTTTGG - Intergenic
1067607020 10:47673937-47673959 CCTTAGGGTCCTCTTGGTTTTGG + Intergenic
1069725787 10:70577134-70577156 CTTTGCTGACTTTTTTGTTTGGG + Intergenic
1071335219 10:84594848-84594870 CCTTGGGGCACTTTATGTGTGGG + Intergenic
1071622575 10:87135296-87135318 CCTTAGGGTCCTCTTGGTTTTGG + Intronic
1072455694 10:95573789-95573811 TCTTAGGGACATTTTTGTTTGGG - Intergenic
1072676613 10:97471026-97471048 CCTTGGGAACTTTTGTCTTTAGG + Intronic
1072766042 10:98095991-98096013 TCTTGGGGACCATTTTCCTTTGG + Intergenic
1074393680 10:113079171-113079193 CCTGGGGAGCCTTTTGGTTTTGG + Intronic
1074413952 10:113250717-113250739 CTTTGGGGACCTCTCTGTTTAGG + Intergenic
1076109534 10:127850225-127850247 CCTTTGGGAATATTTTGTTTGGG + Intergenic
1077509658 11:2950872-2950894 CTTTGGGGCTCTTTTTGTTAAGG - Intronic
1077552865 11:3209297-3209319 CCTTGGGGACCCATGTGCTTTGG + Intergenic
1078454926 11:11467536-11467558 CCTTGGGGACATTTATGGCTGGG - Intronic
1078881227 11:15450855-15450877 TCCTAGGGACCTTTTTGCTTAGG + Intergenic
1080141724 11:28929073-28929095 TTTTGGGGCCATTTTTGTTTTGG + Intergenic
1080349110 11:31361321-31361343 CCTTTTGGACCTTTTTGCTCTGG - Intronic
1081675222 11:44964746-44964768 CCTTGAGGCCCTTTTGGTTCAGG - Intergenic
1085629977 11:78106854-78106876 CCTTGAGCTCCTTTATGTTTGGG - Exonic
1087751895 11:102015220-102015242 CCTTGTTCACATTTTTGTTTTGG - Intergenic
1090972150 11:131653199-131653221 TCTTAGGGACCTTTTTTTTGAGG + Intronic
1091344571 11:134844183-134844205 CCCTGGAGGCCTTCTTGTTTGGG - Intergenic
1092199608 12:6572126-6572148 CCCTGGCCACCTTTTTTTTTTGG - Intronic
1093440827 12:19193839-19193861 CCTTGGGGAGCTTTTACTTATGG + Intronic
1093953194 12:25187721-25187743 CCTTGGGGACCTTTTTGTTTTGG - Intronic
1094290045 12:28837472-28837494 TCTTGGGTACCTATATGTTTAGG - Intergenic
1094624578 12:32111254-32111276 CATTGGGCAGCTTTTTCTTTTGG + Intronic
1098912681 12:76225684-76225706 CCTTGGCCACCTTTTGGTCTAGG + Intergenic
1100454339 12:94737429-94737451 CCTTCAGGACTTTTTTGGTTTGG + Intergenic
1100632035 12:96399589-96399611 CCGAGGGGACCTTTGTGTCTCGG + Intronic
1100800725 12:98227751-98227773 CCTTGGGAACCCTTTATTTTAGG + Intergenic
1101610319 12:106285206-106285228 GCTTGGGGGCCTATTTTTTTAGG - Intronic
1102612444 12:114124407-114124429 CCTTGGTTAGCTGTTTGTTTAGG - Intergenic
1104517322 12:129439972-129439994 CATTGGGGACATGTTTGTCTTGG - Intronic
1107441541 13:40432084-40432106 CCTTGGGCATTTTTTTCTTTGGG - Intergenic
1108315048 13:49228578-49228600 CCTTGGGGCCCTCTTTGTGCAGG + Intergenic
1109498158 13:63202472-63202494 CCTTGGGGATCTTTTTTATCAGG - Intergenic
1117963268 14:61182946-61182968 GATTGGGGATATTTTTGTTTTGG - Intergenic
1118073752 14:62275986-62276008 CTTTCTGGACCATTTTGTTTTGG + Intergenic
1118432329 14:65731793-65731815 CCTTAGGTACCCTTTTGATTTGG + Intronic
1118711466 14:68523059-68523081 CCCCGGGGACCCTTTTGTTTTGG + Intronic
1119540782 14:75436841-75436863 CCTTGTACACCTTTTTGGTTGGG + Intronic
1119603600 14:75995332-75995354 CCTTGGGGTCCTTTTGGAATGGG + Intronic
1121464806 14:94108858-94108880 CCAGGGTGGCCTTTTTGTTTTGG + Intronic
1121588740 14:95082891-95082913 CCTTGGTAAGCTTTTCGTTTGGG + Intergenic
1121819280 14:96953272-96953294 CTTCGGGATCCTTTTTGTTTGGG - Intergenic
1121989521 14:98542290-98542312 TCTTGGGTACCTTTCTGTCTGGG - Intergenic
1126471062 15:49011024-49011046 CACTGGGGACATGTTTGTTTAGG - Intronic
1126644692 15:50863300-50863322 CTTTGTTGACCTTTTTGTTTTGG + Intergenic
1127288676 15:57551870-57551892 CCTGGGGGACGTTTTTCCTTTGG - Intergenic
1128519154 15:68364339-68364361 CCTTGGGGAGCTAGTTGTCTGGG - Intronic
1129864151 15:78890373-78890395 CCTTTGACACCTTTTTTTTTTGG + Intronic
1131059695 15:89397172-89397194 CCCTGAGGACCTGCTTGTTTGGG + Intergenic
1132172901 15:99681065-99681087 CTTTGGGGACTTTTTACTTTGGG + Intronic
1133874017 16:9716170-9716192 CATTGGGGATCTTATTATTTTGG + Intergenic
1134237278 16:12476935-12476957 CCTTGGGGACTTTTCTCTCTGGG + Intronic
1142643447 17:1298099-1298121 GCTTGGGAACCTCTTTGGTTTGG - Intronic
1146043502 17:29481604-29481626 CCTTGGGAGCCTCTTTCTTTTGG + Intronic
1146183305 17:30710188-30710210 CCTTGGCGCCCTGTTTGTGTAGG + Intergenic
1151375872 17:73688771-73688793 CCTCGGGGACCTTGTTCTTTAGG + Intergenic
1151980959 17:77508152-77508174 CCTTCGGGAGCTTTATGTTCGGG + Intergenic
1152387654 17:79984747-79984769 GCTTGGGGCTATTTTTGTTTTGG - Intronic
1153364585 18:4241089-4241111 CCCTGGGTAACTTATTGTTTTGG - Intronic
1153438120 18:5088329-5088351 CCTTTTGGACCTGTTTGTCTTGG - Intergenic
1153680027 18:7491751-7491773 CCTTGGGGACCGTTCTGATGAGG - Intergenic
1156075719 18:33276578-33276600 CCTTGGAAACCTTTTTCTTTTGG - Intronic
1156160036 18:34348630-34348652 CCTTAGCAATCTTTTTGTTTAGG - Intergenic
1156519865 18:37713225-37713247 CCTTGAGGACCTTTGTTTTCTGG + Intergenic
1157921330 18:51715717-51715739 CCATGTGGACCTTTCTGCTTGGG - Intergenic
1158914257 18:62105182-62105204 GCTTTGAGACATTTTTGTTTTGG + Intronic
1159457156 18:68674034-68674056 GCTTTGGGACCTTTTTATTTTGG - Exonic
1160712192 19:557310-557332 CTTTGTGGACCTTTCTGTTTGGG - Intergenic
1164130509 19:22357382-22357404 CATGGGGGGCCTTTATGTTTAGG + Intergenic
1164445302 19:28312501-28312523 CCTTGAGGACCATTTTGGTGGGG - Intergenic
925318695 2:2944521-2944543 TCTAGGGGTCCCTTTTGTTTAGG - Intergenic
925594277 2:5539831-5539853 CCTTTGGGTCCTTTCTGCTTGGG + Intergenic
926919409 2:17926072-17926094 CCTTTGGGGCCAATTTGTTTGGG - Intronic
929063751 2:37950888-37950910 CTTTGGGAATCTTTTTGTTCTGG + Intronic
931175570 2:59851139-59851161 ACTTGGAGACCTTTCTGATTTGG + Intergenic
932386032 2:71333312-71333334 CCTTGGGGATTTATTTGTCTTGG + Intronic
932609888 2:73191061-73191083 CCTTGGGGACTGCTATGTTTAGG - Intergenic
935408416 2:102734357-102734379 CCTTGAGGCCCGTTTTGTTTAGG - Intronic
935701048 2:105812273-105812295 CCTTGGACACCTTTGAGTTTCGG + Intronic
937136542 2:119558401-119558423 GCCTGGGAAACTTTTTGTTTGGG + Intronic
937228827 2:120385011-120385033 CCTTGGGCACCCTGTGGTTTGGG + Intergenic
939177833 2:138770124-138770146 CCATTTGGGCCTTTTTGTTTTGG - Intronic
941436110 2:165475289-165475311 CCTTGGGGCCCTTATTGATTTGG - Intronic
941730070 2:168907797-168907819 CCTTGGGGTCCTCTTTGGCTTGG + Exonic
941775565 2:169389419-169389441 CCTTGGGGATGCTATTGTTTAGG + Intergenic
942917168 2:181324635-181324657 CCTTGGAGAACTTTTCCTTTTGG - Intergenic
944380865 2:199109561-199109583 CCTTAGGGACTTTGTTGTCTAGG - Intergenic
946559008 2:220891690-220891712 TCTTGGGTACATGTTTGTTTTGG + Intergenic
946961412 2:224989510-224989532 CCTTTGGGTCACTTTTGTTTAGG - Intronic
947243170 2:228018262-228018284 CGTTGGGGACCTTTGTCCTTCGG + Exonic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173784417 20:45782352-45782374 TTTTGGGGGCTTTTTTGTTTTGG + Intronic
1174143735 20:48435774-48435796 TTTCTGGGACCTTTTTGTTTTGG + Intergenic
1174954363 20:55080288-55080310 CCTTGAGGATCTCTCTGTTTAGG - Intergenic
1175082643 20:56433858-56433880 CTTTGGGGACCTTTTTTCTATGG + Intronic
1178022819 21:28429565-28429587 CCTTCAGGACCATTTTTTTTAGG - Intergenic
1181567015 22:23745029-23745051 CCTGGGGGACCCTTTTCTTCAGG - Exonic
1182342028 22:29630877-29630899 ACTTGAGGGCCTTTTTGTTAGGG - Intronic
949545218 3:5066716-5066738 CCATGGGGAGCTTTCTGCTTTGG - Intergenic
951624899 3:24648935-24648957 CCTTATGAACCTTTTGGTTTTGG + Intergenic
954296995 3:49679779-49679801 CCTTGGGGACCTGTTAGTAAAGG - Intronic
954674503 3:52308356-52308378 CCTTGGGGACCTGCCTGTGTGGG + Intergenic
954865267 3:53723602-53723624 CCCTGGGGATCTCTGTGTTTCGG + Exonic
955133488 3:56192945-56192967 CCTTTGGGACCCTTTTCATTGGG - Intronic
956247413 3:67199085-67199107 GCTTGGGGACATTTTTGCTTAGG - Intergenic
957022432 3:75140450-75140472 CATGGGGGGCCTTTATGTTTAGG - Intergenic
957173883 3:76778628-76778650 ATTTGGGGATCTTTCTGTTTTGG + Intronic
957673708 3:83339684-83339706 CCTTGGCCACCTTTTGGTCTAGG - Intergenic
959262498 3:104099484-104099506 CCAGTGGGACCTTTTTATTTTGG - Intergenic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
962551152 3:136493360-136493382 CTTTGCTGATCTTTTTGTTTTGG - Intronic
968710901 4:2116708-2116730 CCTTCGTGACCTTATAGTTTGGG - Intronic
970625620 4:17875727-17875749 ACTTGGGGACCTATTTTTTTTGG + Intronic
971623066 4:28882201-28882223 CCTTGGGGATATTTTTGTACAGG + Intergenic
971825010 4:31609919-31609941 TCTTAGGGACCTTTCTATTTTGG - Intergenic
973010958 4:45072167-45072189 CCTTATGGACATTTTTGTTGTGG + Intergenic
974184613 4:58430329-58430351 CCTGGAGGACCTGTTTGTTGAGG + Intergenic
975532176 4:75412089-75412111 CCTTGGGGACCTGTTTGCCAGGG + Intergenic
977727407 4:100312229-100312251 CCTTGGCTACCATTTTGTTTTGG + Intergenic
978094441 4:104758375-104758397 CCTCGGGCCCCTATTTGTTTGGG + Intergenic
978488088 4:109278980-109279002 CCCTAGGGACCTTTTTATATGGG + Intronic
980671223 4:136009233-136009255 GCTTGGGGAACTTCTAGTTTTGG - Intergenic
982148738 4:152428063-152428085 CCTTGGGTATGTTTTTGGTTTGG + Intronic
983864044 4:172742215-172742237 CCTGGTGAACCTGTTTGTTTGGG + Intronic
986471424 5:8080692-8080714 CTCTGGGGACCTTATAGTTTTGG + Intergenic
986599866 5:9462124-9462146 ACTTGGTGAACATTTTGTTTAGG - Intronic
987197811 5:15544753-15544775 CATTGTGGCCCTTATTGTTTGGG + Intronic
989321252 5:40136882-40136904 CATTGGGAACCTTTGTGTTAGGG - Intergenic
989622258 5:43396280-43396302 CCTTGTGGCCATTTTGGTTTTGG + Intronic
990396129 5:55380768-55380790 TCTTGGTGACATCTTTGTTTGGG + Intronic
990967654 5:61466446-61466468 CCTGGGGGTTCTTTTTATTTAGG + Intronic
991066854 5:62433081-62433103 CTGTGGGAACCTTTTTATTTTGG + Intronic
992189775 5:74280421-74280443 CCTTGGGGACCCATTGCTTTTGG + Intergenic
994009015 5:94878021-94878043 CCATGGGGGCCTTTTATTTTGGG + Intronic
994054345 5:95399009-95399031 CCTTGGCCTCCTTTTTGTTCAGG - Intronic
994736307 5:103560945-103560967 GCTTTGTCACCTTTTTGTTTCGG + Intronic
995152671 5:108867563-108867585 CCTTGGCAACCTTTGTGTTAAGG + Intronic
995357414 5:111254863-111254885 CCCTGGGGACTTTTGTGGTTTGG + Intronic
996372004 5:122763495-122763517 CCATGTTGACCTTTTTGTTATGG - Intergenic
997592198 5:135081581-135081603 CTTTTAGGACCTTTTTTTTTTGG + Intronic
1002003446 5:176212917-176212939 ACTTGAGCAGCTTTTTGTTTGGG - Intergenic
1002223012 5:177698002-177698024 ATTTGGGCAGCTTTTTGTTTGGG + Intergenic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1006335309 6:33417491-33417513 CCTTGGCGACCTTCTCGTTGGGG + Exonic
1006939090 6:37739779-37739801 CCTTGGGTACCTCTTTGTGCTGG - Intergenic
1011865463 6:91820507-91820529 CTTTGGGTATCTTTCTGTTTGGG + Intergenic
1012080620 6:94753475-94753497 CCTTGGTAAGCTGTTTGTTTAGG + Intergenic
1016309137 6:142714521-142714543 CCTTAGAGACCATTTTGCTTTGG - Intergenic
1018829069 6:167428576-167428598 CTTTGGGGAGTTTTTAGTTTTGG - Intergenic
1020630742 7:10636783-10636805 CCTTGAGGACCTCTTTGCGTTGG - Intergenic
1021005109 7:15384911-15384933 CTTTGGGGATCATTTTTTTTTGG - Intronic
1022016379 7:26352431-26352453 CCTTGCGTATTTTTTTGTTTTGG - Intronic
1023439162 7:40168889-40168911 CCTTGCGGATCTTTTGGCTTCGG + Intronic
1024711121 7:52015791-52015813 CTTTGGGGACATTTTGTTTTAGG + Intergenic
1029733028 7:102450291-102450313 CCGTGGGGAGCCGTTTGTTTAGG - Exonic
1030136428 7:106255730-106255752 CCTTGGGTACCTTTAGGTTCAGG - Intronic
1031719442 7:125152996-125153018 CCTTGGGGAACTTTTACTCTTGG - Intergenic
1032170703 7:129582332-129582354 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1034255829 7:149724204-149724226 GCTTGGGGTCCTGTGTGTTTGGG + Intronic
1038263301 8:26017047-26017069 CCTTGGGGAAGGTTGTGTTTGGG - Intronic
1038872547 8:31511061-31511083 TCTGGGGCACCTTTTTTTTTTGG + Intergenic
1039278313 8:35955776-35955798 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1039370102 8:36975669-36975691 ACTTGGGGACCTTTAAGTTGGGG - Intergenic
1039743408 8:40402441-40402463 CCTTGGGGAGCTTTTGCTTATGG + Intergenic
1042339741 8:67666518-67666540 CCAAGGGGAACTTTCTGTTTGGG - Intronic
1043533765 8:81177544-81177566 CCTTGGGGAGCTTTTATTTGTGG + Intergenic
1044581043 8:93826503-93826525 CCTTGGAGACCATTTCTTTTGGG - Intergenic
1046685061 8:117215686-117215708 CCTTAGGGACCTCTTTCCTTGGG - Intergenic
1048212924 8:132471051-132471073 CTTATGGTACCTTTTTGTTTGGG + Intronic
1050332199 9:4556727-4556749 CCTTGGGGACGATATTGTCTTGG - Intronic
1052672662 9:31577906-31577928 CCCTGGCTACGTTTTTGTTTTGG - Intergenic
1053942060 9:43261309-43261331 CCTTGGTTACATTTTTGTCTGGG - Intergenic
1057332646 9:94129948-94129970 CCTTGGGGAGCTTTTACTTATGG - Intergenic
1058411975 9:104743604-104743626 CCCTGGGTACTTTCTTGTTTGGG - Intergenic
1060960298 9:127676066-127676088 CCTAGGGGCCCTTTTTGTTTGGG + Intronic
1061212593 9:129202515-129202537 CCTTGTGGCCCCTGTTGTTTTGG + Intergenic
1061330111 9:129886888-129886910 CTTTGGGGACCTCATTGCTTGGG - Intergenic
1061642497 9:131970161-131970183 CCTTGGTGACCCTTTTGTAAGGG - Intronic
1062206708 9:135341633-135341655 CCTTGGCGTCCTTCTTGCTTGGG - Intergenic
1203781411 EBV:103001-103023 TGTTGGAGACCTTTTTCTTTAGG - Intergenic
1203781763 EBV:104901-104923 ACTCGGGGCCCTTTTTGGTTTGG - Intergenic
1186328995 X:8512166-8512188 CCTTGGTGTCATCTTTGTTTTGG - Intergenic
1186596180 X:10984135-10984157 CCTTGGAGCCTTGTTTGTTTGGG - Intergenic
1186870214 X:13764194-13764216 CCTTGGGAACCTTAAAGTTTGGG + Intronic
1187036527 X:15546021-15546043 CCATGAGCACCTTTTTATTTTGG + Intronic
1187386307 X:18851932-18851954 GCTTGGGTTCCTTTCTGTTTGGG - Intergenic
1187991734 X:24881612-24881634 CCCTGGGGAACAATTTGTTTTGG - Intronic
1188836599 X:34964400-34964422 CACTAGGCACCTTTTTGTTTTGG - Intergenic
1190314891 X:49144305-49144327 GCTAGGGGGCCTTTATGTTTAGG + Intergenic
1194627718 X:96244941-96244963 CCTTTGGGAACATTTTGTTAAGG + Intergenic
1196103322 X:111870214-111870236 TCTTGGGGACAGATTTGTTTTGG + Intronic
1196869562 X:120099843-120099865 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1197982046 X:132227457-132227479 CCTTGGGGAGCTTTTACTTATGG + Intergenic
1198491974 X:137150852-137150874 TCTTTGGGTCCATTTTGTTTGGG + Intergenic
1198656683 X:138922324-138922346 CCTTGGGGCCATTTTGATTTCGG - Intronic
1201866849 Y:18665350-18665372 TTTTGGGGACCTTTTTGTGGTGG + Intergenic