ID: 1093955638

View in Genome Browser
Species Human (GRCh38)
Location 12:25214863-25214885
Sequence CAGGGGGAAAAGAGGGCGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 378}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093955638 Original CRISPR CAGGGGGAAAAGAGGGCGGT AGG Intronic
900084031 1:878528-878550 GAGGGGGTAAAGAGGGAGTTGGG - Intergenic
900190813 1:1351452-1351474 GATGGGGAAGAGAGTGCGGTGGG + Intergenic
900342212 1:2194594-2194616 CAGGGGGAGAATAGAGCGGGAGG + Intronic
900693544 1:3995993-3996015 CATGTGGAAAAGAGGATGGTGGG + Intergenic
900745242 1:4356431-4356453 CAGGGGCAAATGAGAGGGGTGGG - Intergenic
900752364 1:4406711-4406733 CAGAGGGAAAAGAGTACGGTAGG + Intergenic
901101715 1:6724232-6724254 CAGGAGGAAAAGAGAGCGAAGGG + Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
902383539 1:16063947-16063969 CAGGAGCAAAAGAGGACGGGAGG - Intronic
903233857 1:21937322-21937344 CGGGGAGGAAAGGGGGCGGTGGG - Intergenic
903664625 1:24998776-24998798 CAGGGGGAAGGGAGGGTGCTGGG - Intergenic
903785598 1:25859249-25859271 CTGGGGGATGAGAGGGCGTTGGG - Intronic
904212991 1:28897959-28897981 CAAGGGGAAAAGAGCTAGGTTGG + Intronic
904883184 1:33715755-33715777 CAGGGAGAAAAGAGGACCCTTGG - Intronic
906261032 1:44390252-44390274 CAGGGAGAGAAGAGAGGGGTTGG + Intergenic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
907509202 1:54945832-54945854 GAGGGGGAGAAAAGGGAGGTGGG + Intergenic
908359923 1:63358858-63358880 CAGGGCGAGAAGTGGGAGGTGGG + Intergenic
909971197 1:81992127-81992149 CAGAGGGCAAAGAGGGCACTGGG + Exonic
912560813 1:110550318-110550340 GAGTGGGAAAAGAAGGCGGTTGG - Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
912832502 1:112966223-112966245 AGGGAGGAAAAGAGGGAGGTGGG - Intergenic
912948596 1:114105295-114105317 CAGGGGGGGAACAGGGCTGTAGG - Intronic
913089412 1:115466357-115466379 CAGGGAGGAAGGAGGGCTGTGGG - Intergenic
913237588 1:116798130-116798152 ATGTGGGAAAAGAGGGCTGTAGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
915355233 1:155251767-155251789 CTGGGGGATAGTAGGGCGGTGGG + Exonic
917316943 1:173735747-173735769 CAGGGGGAAGTGTGGGAGGTGGG - Intronic
918095044 1:181327534-181327556 CTGGGGGGAAAGATGGGGGTTGG - Intergenic
918490453 1:185075658-185075680 CAGGAGGAAGAGAGAGCAGTGGG + Intronic
921217596 1:212950821-212950843 CTCGGGGAAAAGGGGGCGGATGG + Intronic
922128067 1:222748839-222748861 CAGGGGTAAGAGAAGGCTGTCGG + Intronic
922853565 1:228755253-228755275 CATGGGGTAAAGTCGGCGGTGGG + Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924294385 1:242570663-242570685 GTGGGGGAATAGAGGGCTGTGGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1064443771 10:15375565-15375587 CAGAGGAAAAAGAGGAGGGTTGG - Intergenic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1068669625 10:59709910-59709932 GAGGCGGAAAAGCGGGCGGTAGG + Exonic
1068798757 10:61115111-61115133 CAGGCTGAAAAGAGAGAGGTTGG - Intergenic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069619535 10:69828273-69828295 CAGGAGGAAGAGATGGGGGTGGG - Intronic
1070001150 10:72378427-72378449 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
1070471064 10:76779926-76779948 CAAGGGCAAGAGAGGACGGTGGG + Intergenic
1070857273 10:79615898-79615920 TAGGGGGAGAAGTGGGAGGTGGG - Intergenic
1071222869 10:83490269-83490291 CATGGGGAAAAGAGTGCAGAAGG - Intergenic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1072314889 10:94192334-94192356 GAGGGGGAAGAGAGGGAGGTGGG - Intronic
1072661523 10:97366495-97366517 CATGGCTGAAAGAGGGCGGTGGG - Exonic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1075846279 10:125547259-125547281 CAGGAGGAAAAAAGGGTGGCTGG + Intergenic
1076328509 10:129646919-129646941 CAGAGGGGAAAGAGGACGGAGGG - Intronic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1078332416 11:10436164-10436186 CAGGGGGACAAGAAGGCGAAAGG + Intronic
1079696175 11:23484566-23484588 CAGGGGGAAGAGGTGGCTGTGGG + Intergenic
1080394001 11:31873428-31873450 GAGGGAGAGAAGAGGGTGGTTGG + Intronic
1080419042 11:32093964-32093986 GAGGGGGAGAAGAGAGAGGTAGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082004888 11:47414022-47414044 CAGGGGGAACAGTGTGAGGTGGG - Intronic
1083939029 11:65885257-65885279 CAGGGGGGAAATAAGGTGGTGGG - Intronic
1084055078 11:66626700-66626722 GAGGGAGAAAAGAGGTGGGTAGG + Exonic
1084889880 11:72231437-72231459 CAGGGGGAAATGCAGGCAGTGGG + Intronic
1086085980 11:82955977-82955999 CTGGGGGAAAGGATGGCTGTGGG - Intronic
1088322366 11:108567381-108567403 CAGGTGGATAAGTGGGAGGTAGG - Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090896068 11:130976683-130976705 CTGGGGGAAAAGGCGGCTGTGGG - Intergenic
1090939080 11:131371997-131372019 CAGGGGGAGAAGAGGGCGAGGGG - Intronic
1091231116 11:133988618-133988640 CAGAGGGAAAAGAGGGCGAGTGG - Intergenic
1091284779 11:134402521-134402543 CAGGTGTAACAGAGGGAGGTGGG - Intronic
1091998579 12:5015169-5015191 CACAGAGAAAAGAGGGCGGGTGG + Intergenic
1093289200 12:17300926-17300948 TAGAGAGAAAAGATGGCGGTTGG + Intergenic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094319217 12:29167361-29167383 AAGAAGGAAAAGAGGGAGGTTGG - Intronic
1095347593 12:41169649-41169671 CAGAGGGAAAATAGGGAGATAGG + Intergenic
1096160377 12:49371735-49371757 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1097281772 12:57849210-57849232 CAGCAGGAAAAGAGAGCGATAGG - Intergenic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1099383880 12:81990171-81990193 AAGGGGGAAAAGTGGGCTGGAGG + Intergenic
1100002552 12:89855049-89855071 CAGGAGCAAGAGAGGGGGGTAGG + Intergenic
1100644714 12:96516547-96516569 CTTAGGGAATAGAGGGCGGTCGG + Intronic
1103053210 12:117798677-117798699 GAGGAGGAAAAGGGGGAGGTAGG + Intronic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1106455118 13:29920109-29920131 TAGAGGGAACAGAGGGGGGTTGG - Intergenic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1110449178 13:75621959-75621981 TAGGTGGAAAAGAGGTCAGTAGG + Intronic
1110783238 13:79491110-79491132 CAGGGAGAAAGAAGGGAGGTAGG - Intronic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1112673488 13:101669992-101670014 GAGGGGGAAAAAAAGGCAGTAGG - Intronic
1113425024 13:110200546-110200568 CCGTGGGAAAAGAGGGGGGCAGG + Intronic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1113926862 13:113946608-113946630 CAGGGTGAAAGGAGGGCACTGGG + Intergenic
1114277979 14:21165120-21165142 CCGGGGGAAAAGATGGCTCTGGG + Intergenic
1115013273 14:28577013-28577035 CAGGGGGAAAGGTGGGAGGGAGG + Intergenic
1115508195 14:34112640-34112662 TAGGGGTGGAAGAGGGCGGTGGG + Intronic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117440706 14:55756564-55756586 CAGGGAGAAAAGAGGTGGGTTGG + Intergenic
1118600314 14:67467433-67467455 CAGGGCAAAAAGAAGGCTGTGGG + Intronic
1119041893 14:71282027-71282049 CCTGGGGAAGAGAGGGAGGTAGG - Intergenic
1119400510 14:74359221-74359243 CAGGGGGTTTAGAGGGGGGTTGG + Exonic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1122022604 14:98851610-98851632 CAGGGGGCAAAGAGGAAGGCTGG + Intergenic
1122910609 14:104826132-104826154 CAGGGGGATATGCGGGGGGTGGG + Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1126490776 15:49233244-49233266 CAGGAGGAAGAGAGAGAGGTGGG + Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1132010737 15:98274048-98274070 AAGGGGGAAGAAAGGGAGGTGGG - Intergenic
1132079945 15:98855141-98855163 CAGGAGGAAAAGATGACTGTGGG - Intronic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132626551 16:894251-894273 CAGGGGGACAGGTGGGCGGACGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1134608534 16:15589929-15589951 TATGGGGAAAAGAGGGCGGTGGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134753259 16:16643470-16643492 CAGGTGGAAATGAGTGCAGTGGG + Intergenic
1134760047 16:16706211-16706233 CAGGGAAAAAAGAGGCCGATAGG + Intergenic
1134986024 16:18652994-18653016 CAGGGAAAAAAGAGGCCGATAGG - Intergenic
1134992796 16:18715614-18715636 CAGGTGGAAATGAGTGCAGTGGG - Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1136315788 16:29454150-29454172 CAAGGGGAAAAGAGCTCGGGGGG - Intronic
1136430365 16:30193492-30193514 CAAGGGGAAAAGAGCTCGGGGGG - Intronic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1137904695 16:52309410-52309432 AAGGGGGAAAAGAGAGAGGTTGG - Intergenic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1140262283 16:73390792-73390814 CAGGGGGAGAAGTGGGTGTTTGG - Intergenic
1140840188 16:78831224-78831246 AAGGGGGAAATGAGGGCTGGAGG - Intronic
1141745839 16:85925788-85925810 CAGGGGGATAAAAGGCAGGTGGG - Intergenic
1142109754 16:88325018-88325040 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143916117 17:10294704-10294726 CAGGAGGAAAAGAGAGAAGTGGG + Intergenic
1144088275 17:11830315-11830337 CATGAGGAAAAGAGGGTTGTTGG + Intronic
1145079071 17:19879673-19879695 AAGGGGGAAAAGAGGGAGGTGGG - Intergenic
1145193717 17:20868916-20868938 GAGGGGGAAAAGAGGGTGGCAGG + Intronic
1145351943 17:22091140-22091162 GAGGGGGAAAAGAGGGTGGCAGG + Intergenic
1146172734 17:30646015-30646037 GAGGGGGCAAAGAGGAGGGTAGG + Intergenic
1146346192 17:32062024-32062046 GAGGGGGCAAAGAGGAGGGTAGG + Intergenic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147949131 17:44097285-44097307 CTGGGGGAGAAGAGGCTGGTGGG - Intronic
1148543904 17:48502416-48502438 CTGGGGGAAAAGAGGGCTGTGGG - Intergenic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149611139 17:57958302-57958324 CAGGGGGAATAGAGTGGGGCAGG + Intergenic
1150210493 17:63438714-63438736 CAGGAGGAAAGGAGAGCGGGTGG + Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1151144337 17:72026966-72026988 AAGGGGAAAAAGAGGGTGGGGGG + Intergenic
1151803376 17:76390812-76390834 CTTGGGGAGAAGAGGGCAGTGGG + Exonic
1151868075 17:76818065-76818087 CAGGAGGAAGAGAGGGGGGAGGG + Intergenic
1151896909 17:76986734-76986756 CAGGGGACAAAGAGGGCTGGGGG + Intergenic
1153210743 18:2761261-2761283 AAGAGGGGAAAGAGGGAGGTGGG + Intronic
1153784880 18:8525906-8525928 CAGGGAGAGAAGGGGGCTGTGGG - Intergenic
1155352187 18:24917640-24917662 CAGGGGAGGAAGAGGGCGGGGGG + Intergenic
1156321240 18:36025418-36025440 CTGGGGGAAAAGGGGGTTGTGGG + Intronic
1156465592 18:37346340-37346362 CAGGGGGAAAAAAGAGCTCTAGG + Intronic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158380081 18:56920042-56920064 GAAGGGGAGAAGAGGGCGGGGGG - Intronic
1159812297 18:73030237-73030259 AAAGGGGAAAAGTGGGCAGTGGG + Intergenic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1161415735 19:4145450-4145472 GAGGGGGAGAAGGGGGAGGTGGG + Intergenic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161793866 19:6375591-6375613 CAGGCGGGCAAGGGGGCGGTGGG + Exonic
1162028770 19:7908576-7908598 CAGGAGGAAAAGAGGGGAGAGGG + Intronic
1162433401 19:10642852-10642874 CAGGGGGAAAATGGGGTGGTCGG - Intronic
1162766428 19:12922619-12922641 CAGGTGGGAAAGAGGAAGGTGGG + Exonic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1162989697 19:14294072-14294094 GAGGGGGCAAAGAGGAGGGTAGG - Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165144526 19:33722784-33722806 CAGGGAGAAAAGAGAGATGTGGG - Intronic
1165810643 19:38609796-38609818 TAGGGGGAAAACAGGGAGGGAGG - Intronic
1166352739 19:42207811-42207833 CAGGGGGAGATGAGGCAGGTGGG - Intronic
1166366033 19:42279016-42279038 CAAGGGGTAAAGGGGGAGGTAGG - Intronic
1166523288 19:43495447-43495469 CAGGGGGAAGTGAGGACGGTAGG + Intronic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1167116399 19:47491532-47491554 GAGGGGCCAAAGAGGGCAGTGGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167470276 19:49671914-49671936 GAAGGGGGAAGGAGGGCGGTGGG - Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
924998496 2:385445-385467 CAGGGGGGACGGAGGGTGGTAGG - Intergenic
925411274 2:3641187-3641209 CAGGGAGAAAAGAGAGGGGCTGG + Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926420145 2:12687805-12687827 AAAGGGGAAAAGAGGGCTGGAGG + Intergenic
927082312 2:19642656-19642678 CAGTGAGAAAAGGGGGTGGTGGG + Intergenic
928671609 2:33608920-33608942 AAGGGGGAATAGGGGGTGGTAGG - Intergenic
929357930 2:41049456-41049478 GAGGGGGGAAAGAAGGCAGTAGG - Intergenic
930518447 2:52434834-52434856 GAGAGAGAAAAGATGGCGGTTGG + Intergenic
931308712 2:61057883-61057905 CAGGGAGAAGAGAGGGGGTTTGG - Intergenic
931470559 2:62534633-62534655 AGGGGGGAAAAGAGGGAGGGTGG - Intergenic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933701691 2:85259594-85259616 CAAGGGGTAAAGAGAGCCGTGGG + Intronic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
935046053 2:99483783-99483805 CAGGGGGAAAAAATGGCCTTGGG + Intronic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
936778342 2:116001293-116001315 AAGGAGGAAAAGAGGGAGGGAGG + Intergenic
938502240 2:131836159-131836181 CAGGGGGCACAGAGGATGGTGGG + Intergenic
938692311 2:133802842-133802864 CAGAGGGAGAAGAGCGCGATCGG + Intergenic
938804810 2:134796335-134796357 GAGGGGGAAAAGAGAGGGGCAGG - Intergenic
939116856 2:138070935-138070957 CAGGGGGAAGAGGTGGCTGTGGG - Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
940887455 2:159001921-159001943 CTGGGTGAAAAGAGGAGGGTTGG + Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
946138514 2:217667991-217668013 AAGTGGGAAAAGAGGAAGGTGGG + Intronic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
948577813 2:238965529-238965551 CAGGGAGGAAGGAGGCCGGTGGG - Intergenic
948814015 2:240500489-240500511 CAGGGAGAAAAGGAGGCAGTGGG - Exonic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172701571 20:36856433-36856455 CAGGGGGAGAAGGGGGAGATAGG + Intronic
1172973117 20:38887981-38888003 CAGGGGAAAAAGAAGCTGGTAGG - Intronic
1173581554 20:44150488-44150510 CAGGGGAAAAAAAGGCCGCTGGG - Intronic
1173921709 20:46751052-46751074 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
1174296698 20:49550375-49550397 AAGGGGGAAAAGTGGGCTGGAGG - Intronic
1174961862 20:55166853-55166875 CAGGTGGAAAAGAGGCTGGAGGG - Intergenic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1177962406 21:27683794-27683816 CAGGGGGAAAGGAGAGCATTTGG - Intergenic
1178135238 21:29619475-29619497 CAGGGGGAAAAGAGTGGGAAGGG + Intronic
1178277656 21:31253587-31253609 CATGGAAAAAAGAGGGTGGTGGG + Intronic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1178998416 21:37429509-37429531 CAGGAGGAAAAGAGAGAAGTGGG + Intronic
1179273486 21:39869555-39869577 GAGGGGGAGAAGAGGGCAGGAGG - Intronic
1180970002 22:19810368-19810390 CAGGGGCAAAAGATGGGGGGAGG + Intronic
1181024345 22:20119400-20119422 CAGTGGCAAAAAAGGGCAGTGGG - Intronic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1181542199 22:23579574-23579596 CAAGGGGAAAAGAGGAGGGGGGG + Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1182959626 22:34460070-34460092 CTGGGGGAAAAGAGGGCCTTAGG - Intergenic
1183207342 22:36428569-36428591 CAGAGGGAAATTAGGGCTGTAGG - Intergenic
1183432431 22:37773818-37773840 CAGGAGGGAAGGAGGGCGGCTGG - Exonic
1184177605 22:42797866-42797888 CAGGGAGCAAAGTGGGCGGGAGG + Intronic
1184261210 22:43317630-43317652 CAGTGGCAAAAGAGGGCCTTGGG + Intronic
1184317036 22:43702539-43702561 CAGAGGGAAAAGAGAGCTGGAGG + Intronic
950717960 3:14863032-14863054 CAGGGGGAAGTGAGGCGGGTGGG - Intronic
952503910 3:33989896-33989918 CAGAGGGAAAAGAGTGGGGACGG - Intergenic
953352204 3:42223792-42223814 TGGGGGGAAGAGAGGGAGGTGGG - Exonic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
955027372 3:55182821-55182843 CAAGGGGAGAAGGGGGAGGTAGG - Intergenic
955977403 3:64491669-64491691 CAGGGGAAGAAGAGGGAGTTGGG - Intergenic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956633537 3:71340134-71340156 CAGTGGGAAAATAGGGGGGCAGG - Intronic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957931374 3:86882381-86882403 CAGGAGGAAAAGAGAGGGGCAGG + Intergenic
958138680 3:89531966-89531988 AAGGGGGGAAACAGGGAGGTGGG - Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
959875735 3:111380081-111380103 CAGGGGGAAAGGACGGCTGTGGG + Intronic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
965036458 3:163445297-163445319 CAAGGGGAAGAGCGGGAGGTGGG - Intergenic
966093740 3:176172842-176172864 CTGAGGGAAAAGAGGGTGATGGG + Intergenic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
967273459 3:187750262-187750284 CAGGTGTACAAGAGGGCGGTGGG - Intergenic
967512108 3:190323738-190323760 CAGGTGGAAATGAAGGTGGTGGG - Intronic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
969481437 4:7448931-7448953 GAGAGGGAAAAGAGGGAGGGAGG - Intronic
969611903 4:8232191-8232213 GAGGGGGCAAAGGGGGCGGCGGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
971190925 4:24428343-24428365 CAGGGGGAAAAGAGAGAGAGAGG - Intergenic
974021033 4:56692703-56692725 CAAGGGGAAAAGTGGGCGTTTGG - Intergenic
974072055 4:57132783-57132805 TAGGGGGAAAAGGTGGAGGTGGG + Intergenic
974370269 4:61007591-61007613 GAGGATGAAAAGAGGGAGGTAGG + Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
976443722 4:85106612-85106634 AAGTGGGAAAAGAGGGAGGAAGG - Intergenic
976484703 4:85588078-85588100 CAGAGGGAAAACAGGCCTGTGGG + Intronic
980717355 4:136644373-136644395 CAGGAAGAAAAGGGGGAGGTTGG - Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
981173896 4:141658180-141658202 CAGGAGGAAAAGAGAGCAGGGGG - Intronic
981409911 4:144417700-144417722 CAGGAGGAAGAGAGAGAGGTGGG + Intergenic
981884316 4:149654440-149654462 CAGGGGCAACAGAGAGTGGTGGG - Intergenic
983887705 4:172999019-172999041 AAGGGGTAAAAGAGGGCTCTAGG + Intronic
984189012 4:176582392-176582414 CAGGAGGAAGAGAGAGAGGTGGG - Intergenic
984529713 4:180901654-180901676 CAGGAGGAAGAGAGAGCGGGGGG + Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985815719 5:2126276-2126298 CGGGAGGTAAATAGGGCGGTGGG + Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
990040851 5:51377674-51377696 CAGGGGGCCAAGGGGACGGTTGG + Intergenic
990425386 5:55682970-55682992 GAGGAGGAAAAGAGGGAGGGAGG + Intronic
992552223 5:77869569-77869591 CTGGGGGAAGAGCAGGCGGTCGG + Intergenic
992625863 5:78635373-78635395 CTGGGGGAAGAGGGGGCGGTGGG - Intronic
993328236 5:86567687-86567709 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
993351830 5:86858977-86858999 CAGGAGGAAAAGAGAGAAGTGGG - Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994077321 5:95667927-95667949 CAGGAGGAAGAGAGAGAGGTGGG - Intronic
994722737 5:103399796-103399818 CTGGGGGAGAAGTGGGGGGTGGG + Intergenic
994898576 5:105739675-105739697 CAGGAGGAAAAGAGGCAGGTAGG - Intergenic
996430849 5:123375172-123375194 CTGGGGGAAAAAAAGGGGGTAGG - Intronic
997605485 5:135172994-135173016 AAGGGGGAAAAGAGGGAGGCAGG + Intronic
998130449 5:139648909-139648931 CCGGGGGAGGAGAGGGAGGTAGG - Intronic
998168207 5:139856424-139856446 CAGAGGGTAAAGAGGACAGTCGG - Intronic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
999297147 5:150466841-150466863 CAGGAGGAAAAGAAGGCAGGAGG - Intergenic
1000027746 5:157374748-157374770 CATGGGGAAAGGAGGACTGTGGG + Intronic
1000414096 5:160965345-160965367 CAGGAGGAAAGGGGGGCGGGGGG - Intergenic
1001270868 5:170310739-170310761 CTGGGGGTAACGAGGGCAGTGGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002298143 5:178242480-178242502 CAGGGGGGAAAGTGGGCGTGTGG - Intronic
1002441577 5:179267123-179267145 CTGGGGGAAGAGTGGGCGGCGGG - Intronic
1002653295 5:180720724-180720746 CAGGAGGAAGAGAAGGCCGTGGG - Intergenic
1003337038 6:5183633-5183655 AAGGGGGAGAAGAGGGGTGTGGG - Intronic
1003369519 6:5510759-5510781 CAAGAGGACAAGAGGGGGGTGGG - Intronic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1007168509 6:39845973-39845995 AAGGGGGAAATGAGAGAGGTTGG + Intronic
1007673367 6:43575490-43575512 AAGGGGGAGGAGAGGGCTGTGGG + Intronic
1007770679 6:44189600-44189622 CTGGGGGAAATCAGGGCAGTGGG - Intergenic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1011314531 6:86016798-86016820 CAGGGAGGAAGGGGGGCGGTGGG + Intergenic
1011638952 6:89401579-89401601 GAGGGGGAAAAGAAGGCATTTGG - Intronic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1014436579 6:121427389-121427411 TGGGAGGAAAAGAGGGAGGTGGG + Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1016532613 6:145075191-145075213 AAGGAGGAAAAGAGGGAGGGAGG + Intergenic
1017712541 6:157183260-157183282 CAGTGCCAAAAGAGGGCGGTGGG + Intronic
1018211971 6:161490893-161490915 CAGGGGGAAGAGAGAGAGGGAGG - Intronic
1018368322 6:163144948-163144970 GATGGGGAAAAGAGGGTGGGAGG - Intronic
1018393948 6:163362628-163362650 CAGGGGGAGAAGTGGCCGGGAGG + Intergenic
1018445553 6:163854951-163854973 GAGGGGGAAAAGAGGAAGGGAGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019488165 7:1298945-1298967 CAGGGGGAGAGGGGGGCTGTGGG + Intergenic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1020531229 7:9338482-9338504 GAGAGGGAAAAGAAGGAGGTTGG + Intergenic
1021417382 7:20403790-20403812 GAGGGAGAAAAGAGGAAGGTTGG + Intronic
1023371746 7:39518842-39518864 AAGGGAGAGAAGAAGGCGGTGGG - Intergenic
1024309471 7:47956264-47956286 CAGTGGGAAAAGAGAGCGGGAGG + Intronic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1029710331 7:102295705-102295727 CAGGGAGAAAGGAGGGGTGTCGG + Intronic
1029746025 7:102516324-102516346 AATGGGGAAGGGAGGGCGGTGGG - Intronic
1029763963 7:102615303-102615325 AATGGGGAAGGGAGGGCGGTGGG - Intronic
1029882866 7:103835280-103835302 CAGGAGTTAAAGAGGGAGGTAGG + Intronic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1032483109 7:132262472-132262494 GAGGGGGTAAAGAGGGGAGTAGG + Intronic
1033036424 7:137879962-137879984 CAGGGGGCAGAGTGGGCGGAGGG + Exonic
1033247165 7:139727322-139727344 CTGTGGGAAAAGAGGGCTATTGG - Intronic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1033779752 7:144654506-144654528 GAGGGGGAAAAGAGTGAAGTGGG + Intronic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034434022 7:151054564-151054586 GAGGGTGAGAAGTGGGCGGTGGG - Intronic
1034899258 7:154897416-154897438 CAGCAGGAAAAAAGGGCGGAAGG - Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1036290125 8:7480395-7480417 GTGGGGGAAAAGAGGGAGGGAGG + Intergenic
1036331351 8:7831127-7831149 GTGGGGGAAAAGAGGGAGGGAGG - Intergenic
1036920619 8:12851014-12851036 CTGGGGGAAAAGACGGAGGCTGG - Intergenic
1037801999 8:22040957-22040979 CAGGGGGAAAGCAGAGAGGTGGG + Intergenic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1039167896 8:34706841-34706863 AAGGGGGAAAAGAGAGAGGTAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1047062797 8:121247257-121247279 GAGGAGGAAAAGAGAGCGGAGGG - Intergenic
1048755856 8:137737570-137737592 CAGGGGGAAAAGAGCGGGTTGGG - Intergenic
1048957463 8:139548822-139548844 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
1049242348 8:141544344-141544366 CAGGGGGAGAAGCTGGCTGTCGG + Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050351204 9:4741900-4741922 GAGTGGGAAGAGAGGGCGCTCGG - Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053103964 9:35394700-35394722 CAGGAGGAAAGGAGGGAGTTAGG + Intronic
1056000704 9:82213392-82213414 CAGGAGGAATAGAGAGAGGTGGG - Intergenic
1056650894 9:88461142-88461164 CAGGCAGAAATGAGGGCGGCAGG - Intronic
1056796691 9:89663451-89663473 CAGGGAGAAAGGAGTGCTGTTGG - Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060811002 9:126611532-126611554 GAGGGGGAAAGGAGAGCTGTAGG + Intergenic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1062050564 9:134444552-134444574 GAGGGGGAAAGGAGGGAGGGAGG - Intergenic
1062142119 9:134965049-134965071 CCGGGGGAAGAGAGCGTGGTTGG + Intergenic
1062374531 9:136255945-136255967 CAGGTGGCAGAGAGGGGGGTGGG + Intergenic
1062497201 9:136837520-136837542 CAGGGGGCACAGAGGATGGTGGG - Exonic
1062553150 9:137099582-137099604 CATGGGGCAAAGATGACGGTGGG - Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1186718144 X:12275242-12275264 CAGGTGGAAAAGAGAGGGGGAGG - Intronic
1187619469 X:21034658-21034680 CAGGGTGAAAAAATGGGGGTGGG - Intergenic
1187621605 X:21062425-21062447 AAGCAGGAAAAGAGGGAGGTAGG + Intergenic
1187704295 X:21993978-21994000 AAGGGGGAAAGGAGGGAGGGAGG - Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188927370 X:36061149-36061171 AAGGAGGAAGAGAGGGCAGTGGG - Intronic
1189799136 X:44675853-44675875 GAGGAGGGAAAGAGGGCTGTGGG - Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192451473 X:71247688-71247710 GAGGCGGGAAAGAGGGCAGTGGG - Intronic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1192978300 X:76310455-76310477 CGGGGGGAAGAGTGGGAGGTGGG - Intergenic
1195306125 X:103585690-103585712 CAGGGGGAAAGGCTGGGGGTGGG + Intronic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1197098635 X:122625182-122625204 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1197226547 X:123961106-123961128 AAGGGAGAAAGGAGGGCGGGGGG - Intronic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1200075157 X:153547111-153547133 CCGGGGCAGAAGAGGGAGGTGGG + Intronic
1200273606 X:154711564-154711586 AAAGGGCAAAAGAGGGCTGTGGG + Intronic