ID: 1093956676

View in Genome Browser
Species Human (GRCh38)
Location 12:25228444-25228466
Sequence GTGTTGTAGCATGTATATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093956676_1093956678 27 Left 1093956676 12:25228444-25228466 CCTGTATATACATGCTACAACAC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1093956678 12:25228494-25228516 ATGAAGTAAGCCAACACAAAAGG 0: 1
1: 0
2: 5
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093956676 Original CRISPR GTGTTGTAGCATGTATATAC AGG (reversed) Intronic
902822626 1:18952536-18952558 ATGTTGTAGCATGTATTTGTAGG - Intronic
905051940 1:35059323-35059345 TTATTGCAACATGTATATACAGG + Intergenic
905973127 1:42155799-42155821 GTGTTGTAGAATCTTTATTCAGG - Exonic
911606396 1:99910128-99910150 GTTTTGTTGCATGGATATATTGG + Intronic
912757793 1:112339062-112339084 GTGCTGTAGCATCTATCTCCAGG + Intergenic
919557597 1:199078796-199078818 GTGTTGTAACATGTATTAATAGG - Intergenic
920632467 1:207665944-207665966 GTGTTGGACCATGTATACATGGG + Intronic
1064357296 10:14631423-14631445 GTGCTGTAGAATTTATACACTGG - Intronic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1073638015 10:105219323-105219345 GAGTTGTAACATGTATAAAAAGG + Intronic
1073833449 10:107413573-107413595 GTGGTGTAGCATTTACATGCTGG + Intergenic
1073840117 10:107489101-107489123 GTGATGGGGCATGTATATAGTGG - Intergenic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1080362837 11:31535905-31535927 ATGTTGTTGCATGTATAGTCAGG + Intronic
1081211039 11:40334124-40334146 GTGTTTTAGTATGTATACAGAGG + Intronic
1082878155 11:58009653-58009675 GAGTTATTGCATGTATATATGGG - Intergenic
1087494686 11:98876206-98876228 GTTTGCTTGCATGTATATACAGG + Intergenic
1087648248 11:100833001-100833023 GTTTTGTATCCTGTAAATACAGG + Intronic
1087657578 11:100943233-100943255 CTATTATATCATGTATATACTGG + Intronic
1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG + Intronic
1093242460 12:16695080-16695102 GTGTGGGTGCATGTGTATACAGG + Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1098446679 12:70573245-70573267 GTTTTATTGCATTTATATACAGG - Intronic
1109691766 13:65903044-65903066 GTGATGTTGCATGTTTTTACCGG - Intergenic
1114942280 14:27628066-27628088 TTGTTGTAACATGTCTAAACAGG - Intergenic
1123423662 15:20151392-20151414 TTGTTGAAGCATTTTTATACTGG + Intergenic
1123532884 15:21157913-21157935 TTGTTGAAGCATTTTTATACTGG + Intergenic
1126443970 15:48721131-48721153 GTGATGTATCTTGTATATGCTGG - Intronic
1126463795 15:48941783-48941805 GTTTTGTTTCATGGATATACCGG + Intronic
1126524521 15:49636160-49636182 TTGTTGTAGCATGTATCAATAGG + Intronic
1127202733 15:56673973-56673995 GTGTGTTAGAATGTATATGCTGG - Intronic
1130758605 15:86793736-86793758 TTGTTGTTGAATGTATATTCTGG - Intronic
1140735336 16:77893159-77893181 GTGTTGTGTCATGTACATAGTGG + Intronic
1150667458 17:67155383-67155405 TTGTTGTGGCAGGTATTTACAGG + Intronic
1155838021 18:30612072-30612094 GTGTTCTAGCATGTTCTTACTGG + Intergenic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1158953242 18:62516962-62516984 GTGTTTCAGCATGTATTTATGGG + Intergenic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
1164286027 19:23818636-23818658 GTGATTTAGCATGTAAATAGGGG + Intronic
1168273534 19:55263575-55263597 TTTTTGTAGCATGGATATGCAGG - Intronic
928502851 2:31915369-31915391 GAGGAGTAGCATGTATATACAGG - Intronic
930382585 2:50650263-50650285 ATGTTTTATCATGTATATAAAGG - Intronic
930440669 2:51401621-51401643 GTGTTGTAGCATGGAGATAGAGG - Intergenic
934991676 2:98925976-98925998 TTTTTGTAGCATATAAATACTGG - Intronic
935009703 2:99121986-99122008 GTGTTGGAGCATTTAGATACAGG - Intronic
938609475 2:132932709-132932731 GAGTTCTAGGATGTATATTCAGG - Intronic
944590547 2:201213421-201213443 GTGTTGTGACAAGTATATAGAGG + Intronic
945203932 2:207311652-207311674 GTGTTGTTCCATCTATAGACTGG - Intergenic
947954837 2:234179694-234179716 ATGTTGCATGATGTATATACAGG - Intergenic
1169070350 20:2724074-2724096 GTGTTGGAGCTGGTTTATACTGG + Intronic
1182250080 22:28993120-28993142 GTGTTGTAGAATCTGTATTCTGG + Intronic
951819574 3:26793087-26793109 GTGTTGAACCATGTATTTCCTGG + Intergenic
953778012 3:45839802-45839824 GTGGTGGAGCATGTGTGTACTGG - Intronic
954767727 3:52935288-52935310 GAGTTGTAGCTTGTAAATCCTGG - Intronic
955814199 3:62824873-62824895 GTTTTGTAGCATGTGTATGTGGG - Intronic
960605936 3:119505175-119505197 GTTTTGCAGTATGTATATATTGG - Intronic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
966502035 3:180653436-180653458 CTGTCATAGCCTGTATATACTGG + Intronic
970777083 4:19687969-19687991 ATGTTTTAGCAAATATATACTGG + Intergenic
971860331 4:32093777-32093799 TTGTTGTAACATGTCTAAACAGG - Intergenic
973219555 4:47710166-47710188 GAGTTATAGAATGTATAAACAGG - Intronic
975354751 4:73388547-73388569 GTGTTTTAACATTTATATGCAGG + Intergenic
975924205 4:79429366-79429388 ATGTTGTATCATGTATTTCCTGG + Intergenic
982054394 4:151533129-151533151 GGGCTGGAGCATGTATATAAGGG + Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
983603570 4:169558578-169558600 ATGGTGTTGCATGTATAAACAGG + Intronic
987269752 5:16294486-16294508 CTGTTATAGCATGTGTATCCTGG + Intergenic
988428337 5:31090196-31090218 GTGTTTTAACATGTAGATATAGG + Intergenic
993359795 5:86960365-86960387 GTGTTGTAGGTTATATACACAGG + Intergenic
996437385 5:123449838-123449860 CTGTTGCAATATGTATATACTGG - Intergenic
996487103 5:124049375-124049397 ATCTTGTAACATGTATATACAGG - Intergenic
998903965 5:146883730-146883752 ATGTTGTAGCATGCACAAACAGG - Intronic
1000841748 5:166228438-166228460 TTGTTATAGCATGTATTTACTGG + Intergenic
1011403493 6:86990441-86990463 GTGTTGTTGCCAGTCTATACAGG + Intronic
1015419424 6:132988781-132988803 TTGTTATAACATGTATAAACAGG + Intergenic
1018860252 6:167706099-167706121 GTGTAATAGCATGTAAATATTGG - Intergenic
1019040061 6:169096304-169096326 GTGTTGTACCATGTATCAAGAGG + Intergenic
1021449849 7:20774443-20774465 GTGTTTTAGTATGTATATCCAGG - Intronic
1032184915 7:129716529-129716551 GTTTTGAAGTATGTATATATCGG + Intronic
1037082320 8:14802719-14802741 GTGTTTTAGCATGTGTATTGTGG + Intronic
1038608976 8:29041767-29041789 GGGTGGTAGCATGCATATATGGG + Intronic
1041038869 8:53825541-53825563 GTGCTGGAGCATGAATACACAGG + Intronic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1050303946 9:4287284-4287306 GTCATGTATCATGTACATACTGG - Intronic
1051284946 9:15486520-15486542 GTGTTGTAGGATGGATGTACTGG - Intronic
1052321606 9:27173393-27173415 ATGTTCTAGCAGGTATATAAAGG + Intronic
1055205902 9:73729782-73729804 GTCTTGTAGCTTGTTTATGCTGG - Intergenic
1058015608 9:100029304-100029326 TTGTTGTTGCTTGTATATTCTGG - Intronic
1188223987 X:27574672-27574694 GTGTTGTGACAGGTATATGCAGG + Intergenic
1189057928 X:37718577-37718599 GTTCTGTTGCATGTATATGCAGG + Intronic
1196921288 X:120587971-120587993 GTGTTGTTACATGGATATATTGG + Intergenic
1199825859 X:151498577-151498599 GTGTTTTCGCATGTATTTGCAGG + Intergenic