ID: 1093958677

View in Genome Browser
Species Human (GRCh38)
Location 12:25250559-25250581
Sequence GCGCGCGGACGCGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 777
Summary {0: 1, 1: 0, 2: 8, 3: 97, 4: 671}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093958677 Original CRISPR GCGCGCGGACGCGGCGGCGC GGG (reversed) Intronic