ID: 1093958761

View in Genome Browser
Species Human (GRCh38)
Location 12:25250787-25250809
Sequence CAGGCACTGAAGGCGGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 215}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093958761_1093958771 10 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958771 12:25250820-25250842 GCTCCCAGTCCGAAATGGCGGGG 0: 1
1: 0
2: 0
3: 4
4: 43
1093958761_1093958770 9 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958770 12:25250819-25250841 CGCTCCCAGTCCGAAATGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1093958761_1093958778 24 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958778 12:25250834-25250856 ATGGCGGGGGCCGGGAGTACTGG 0: 1
1: 1
2: 0
3: 23
4: 173
1093958761_1093958769 8 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958769 12:25250818-25250840 TCGCTCCCAGTCCGAAATGGCGG 0: 1
1: 0
2: 1
3: 1
4: 29
1093958761_1093958775 15 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958775 12:25250825-25250847 CAGTCCGAAATGGCGGGGGCCGG 0: 1
1: 1
2: 2
3: 2
4: 112
1093958761_1093958768 5 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958768 12:25250815-25250837 CGCTCGCTCCCAGTCCGAAATGG 0: 1
1: 0
2: 0
3: 1
4: 22
1093958761_1093958776 16 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958776 12:25250826-25250848 AGTCCGAAATGGCGGGGGCCGGG 0: 1
1: 1
2: 0
3: 7
4: 67
1093958761_1093958772 11 Left 1093958761 12:25250787-25250809 CCCGCCGCCGCCTTCAGTGCCTG 0: 2
1: 0
2: 1
3: 19
4: 215
Right 1093958772 12:25250821-25250843 CTCCCAGTCCGAAATGGCGGGGG 0: 2
1: 0
2: 0
3: 4
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093958761 Original CRISPR CAGGCACTGAAGGCGGCGGC GGG (reversed) Exonic
900364547 1:2305756-2305778 CAGTCACTTGAGGCTGCGGCGGG - Intronic
900384607 1:2404523-2404545 GAGGCACTGGGGGCTGCGGCCGG - Exonic
900422561 1:2561936-2561958 CAGCCACTGCAGGCTGGGGCAGG + Intronic
900767732 1:4516435-4516457 CAGGCACTGGAGGAGGTCGCGGG - Intergenic
901551332 1:9997774-9997796 CCTGCACGGAAGGCGGCTGCGGG - Intronic
902219912 1:14958200-14958222 CAGGCACTGATGGCGAGGGTAGG + Intronic
902842572 1:19084563-19084585 CAGACACTGGCGGGGGCGGCCGG - Exonic
902914088 1:19625522-19625544 GTGGCACTGAAGCCGGCAGCCGG + Intronic
906292908 1:44631706-44631728 CAGGCACAGGAGGCGGGAGCCGG + Intronic
906960545 1:50417105-50417127 CAGGCAACGAAGGCGACGGCTGG - Intergenic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
908460914 1:64347775-64347797 CAGGCACGGAAGGCTGAGGAAGG + Intergenic
909779936 1:79531759-79531781 CAGAGACTGAAGGCAGAGGCAGG - Intergenic
910851828 1:91656252-91656274 AAGGCACTGAAGGTGGCCTCTGG + Intergenic
913501268 1:119474791-119474813 TTGGCACTGAAGGTGGAGGCTGG - Intergenic
914333584 1:146695627-146695649 GAAGCACTGAAGCCGGCAGCCGG + Intergenic
915543239 1:156581947-156581969 CTGGCACTGGGGGCTGCGGCAGG + Exonic
915597272 1:156902767-156902789 CAGACCCTGAAGCCGGCTGCGGG + Intronic
917565278 1:176206855-176206877 CCGCCACGGAAGGCGGCGACGGG + Exonic
920692822 1:208159803-208159825 CAGGAACTGAAGCCAGGGGCTGG + Intronic
922569682 1:226626648-226626670 CAGCCTCTGCAGGCGGCGCCAGG + Intergenic
1062801936 10:387480-387502 CAGGCAGTGCGGGCGGCGGGGGG + Intronic
1062862999 10:824667-824689 CAGGCACTGCAGGTGGAGCCTGG - Intronic
1062971670 10:1653489-1653511 CAGGCACACAAGGCGTCGGGTGG - Intronic
1062971688 10:1653600-1653622 CAGGCACAGAAGGCGTTGGGTGG - Intronic
1064001065 10:11664230-11664252 CAGGCAGAGAAGGCTGCGGTGGG + Intergenic
1067038924 10:42938392-42938414 CAGGCAGTGAAGGAGGGGCCAGG - Intergenic
1067343090 10:45419777-45419799 CAGGCAAGGAAGGCTGCGGAGGG + Intronic
1067390371 10:45857800-45857822 CAGGCAATCAAGGTGGTGGCTGG - Intergenic
1067872905 10:49978267-49978289 CAGGCAATCAAGGTGGTGGCTGG + Intergenic
1069694097 10:70374164-70374186 CAGGCACTCCAGGCAGTGGCAGG - Intronic
1070137546 10:73707986-73708008 CAGGCAATCAAGGTGGTGGCTGG - Intergenic
1070162419 10:73874248-73874270 CGGGGACCGAAGGCGGCGGGCGG + Intronic
1070167077 10:73906920-73906942 CAGGCACTGAAAGCCGCTTCTGG - Intergenic
1070467560 10:76738836-76738858 CAGGCACTGAGGGCAGGGGTGGG + Intergenic
1071194784 10:83145223-83145245 CAGCTACTGAAGGCTGAGGCAGG + Intergenic
1072608551 10:97002240-97002262 CAGGCACTGCAGGCCTCTGCAGG + Exonic
1073424036 10:103445591-103445613 CAGGCACTCGAGGCGGGGCCGGG - Exonic
1073538360 10:104297913-104297935 CAGGCTCTGAAGTCTGCGGGAGG - Intronic
1075645469 10:124093344-124093366 CAGGCAGCGCCGGCGGCGGCCGG - Intronic
1076183813 10:128431236-128431258 CAGGCAGACAAGGAGGCGGCAGG - Intergenic
1076554238 10:131311644-131311666 CCCGCGCTGACGGCGGCGGCGGG + Exonic
1076769725 10:132656438-132656460 CAGGCACAGCTGGCGGGGGCAGG - Intronic
1076864184 10:133159350-133159372 TGGGCACTGAAGCCGGAGGCTGG - Intergenic
1077116169 11:885576-885598 CAGGCACTGAGGGAGGCCACCGG - Intronic
1077434849 11:2534036-2534058 CAGGCAGTGGAGGCTGCAGCTGG - Intronic
1079180415 11:18188917-18188939 CGGGCGCTGACGGCGGTGGCGGG + Exonic
1082807145 11:57458612-57458634 GAGGGCCTGGAGGCGGCGGCGGG - Intergenic
1083401227 11:62424798-62424820 AGGGCACGGAAGGAGGCGGCGGG + Intergenic
1083751968 11:64765967-64765989 CAGGCGGTGGAGGCGGCGGAGGG + Intronic
1084467489 11:69334520-69334542 CAGCCACTGAAGGTGGCACCAGG - Intronic
1089255695 11:117192778-117192800 CAGGGACTGAGGGCAGGGGCAGG - Intronic
1090780435 11:130002378-130002400 CCGGCGCTGAACGCGGCGCCAGG + Intronic
1091393235 12:138675-138697 CAGGCCCTGCAGGCGGCCGCGGG + Exonic
1091633412 12:2179229-2179251 CAGGCACTCATGGCTGTGGCAGG + Intronic
1092171550 12:6376482-6376504 CAGGCACTGAAGGTGCAGGGAGG + Intronic
1092230698 12:6773966-6773988 CAGGCGCAGACGGAGGCGGCAGG - Exonic
1093958761 12:25250787-25250809 CAGGCACTGAAGGCGGCGGCGGG - Exonic
1097925307 12:65121106-65121128 CTGGCACTGCGGGCGGAGGCCGG - Exonic
1100448487 12:94682931-94682953 CAGCCACTCAAGGCTGAGGCAGG - Intergenic
1102053625 12:109880435-109880457 CCGGCGCTGACGGCGGCGGCCGG - Exonic
1103764638 12:123271563-123271585 CCGGCGTTGAGGGCGGCGGCGGG + Exonic
1103910509 12:124349610-124349632 TAGGCAGTGCAGGCAGCGGCAGG - Intronic
1104891777 12:132143750-132143772 CCGGCCCTGGAGGAGGCGGCCGG - Exonic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106776649 13:33016267-33016289 CTGGCACTGGGGGCGGGGGCAGG - Intergenic
1110705375 13:78597728-78597750 CAGGAAATCCAGGCGGCGGCGGG - Intergenic
1113484687 13:110645480-110645502 AAGACCGTGAAGGCGGCGGCAGG - Intronic
1113664412 13:112131474-112131496 CAGGCCCTGGAGGCTACGGCGGG - Intergenic
1117136152 14:52736106-52736128 AAGGCTCTGAAGGCGGGGGGTGG - Intronic
1119911024 14:78349379-78349401 TAGGCACTGAAGGCTGGAGCAGG - Intronic
1122246681 14:100408014-100408036 CAGGCACTGGGGGCGGGGGTTGG + Intronic
1122354753 14:101116144-101116166 CAGGCCCTGGAGGCAGAGGCTGG - Intergenic
1122549052 14:102540096-102540118 CAGGCTCTGGAGGAGGAGGCCGG - Intergenic
1125479288 15:40069465-40069487 CTGGCAGTGAAGGCGGTGGCAGG - Intergenic
1128360627 15:66959240-66959262 CAGCCACTGAAGATGGTGGCGGG - Intergenic
1128680558 15:69648367-69648389 CAGGCGGAGAAGGGGGCGGCCGG - Intergenic
1129336102 15:74853119-74853141 CAGGCACTGGGGGCGGAAGCAGG + Intronic
1130320501 15:82837124-82837146 CTGGCACTGAAGGTGGAGGAAGG - Intronic
1130901666 15:88211671-88211693 CAGGCACTGAATGTGGCCACAGG + Intronic
1132579814 16:679815-679837 CAGGGGCGGGAGGCGGCGGCTGG + Intronic
1132609360 16:807572-807594 CAGGGACAGAAGACGGCCGCTGG - Exonic
1132880104 16:2158367-2158389 CGGGCACTGGAGGCTGGGGCTGG + Intronic
1132925226 16:2425806-2425828 CAGGCTCTGAGGGAGGAGGCAGG - Intergenic
1132946389 16:2533702-2533724 CAGGAACTGGAGGCTGAGGCAGG - Intergenic
1135111516 16:19693854-19693876 CGGGAATTGAAGGCTGCGGCGGG + Intronic
1135184158 16:20300391-20300413 CAAGCACTGAATGAGGCAGCTGG - Intergenic
1135532485 16:23266461-23266483 CAGGCACTGATGGTGGTAGCTGG - Intergenic
1136301922 16:29340981-29341003 CAGGGACTCAAGGAGGCGTCCGG - Intergenic
1136399518 16:30010082-30010104 CAGGACCTGAAGGGGGCGGCGGG - Exonic
1138478272 16:57284653-57284675 CAGGCGCTGCAGGAGGCGTCGGG + Exonic
1139911700 16:70401208-70401230 TGGCCACTGAAGGCGGGGGCTGG + Intronic
1140000035 16:71015622-71015644 GAAGCACTGAAGCCGGCAGCCGG - Intronic
1141180386 16:81748962-81748984 CAGGCACTGAGGCCTGTGGCGGG + Intronic
1142040792 16:87892783-87892805 CAGGCGCTGGAGGCTGAGGCAGG - Intronic
1142100635 16:88269140-88269162 CAGGCACGGCAGGCGGGAGCTGG + Intergenic
1142558897 17:798366-798388 CAGGCCCTGCAGGTGGAGGCTGG - Intergenic
1142764385 17:2057306-2057328 GAGGCACAGAGTGCGGCGGCCGG - Exonic
1143635759 17:8162999-8163021 CGGGCACTGCGGGCGGGGGCGGG + Intronic
1143775541 17:9196410-9196432 CAGCCACAGGAGGCGGCAGCTGG - Intronic
1143972241 17:10804034-10804056 CAGGCAGAGAAGGCAGCAGCAGG - Intergenic
1144867301 17:18344904-18344926 CAGGGGCTGAAGGTGGAGGCAGG + Intronic
1145372731 17:22320593-22320615 CAGGTACTGGAGGCTGAGGCAGG + Intergenic
1145961388 17:28888280-28888302 TAGGCTCTGCAGGCAGCGGCAGG + Intronic
1145963853 17:28903051-28903073 CAGCCTCCGAAGGCGGAGGCGGG + Exonic
1146313297 17:31787771-31787793 CAGGAAGTGAAGGCAGAGGCTGG + Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148071331 17:44910554-44910576 CAGGCCCTGGAGGAGGGGGCAGG + Exonic
1148116142 17:45176170-45176192 CAGGCAGTGAAGGTGGAGCCAGG + Intergenic
1148645030 17:49215072-49215094 GAGGCAGTGAAGGCGTGGGCTGG + Intronic
1149356585 17:55845697-55845719 CAGGTGCTGAAGGAGGCCGCAGG - Intergenic
1150286273 17:63955971-63955993 CAGCCACTGCAGGGGGCAGCTGG + Intronic
1151010249 17:70484747-70484769 CAGCTACTGACGGCAGCGGCGGG - Intergenic
1151293455 17:73166288-73166310 CAGGCCCTGAGGGAGGCGGGGGG + Intronic
1151818101 17:76481459-76481481 CCGGCTCTGCAGGCGGCTGCTGG + Exonic
1152212424 17:79009574-79009596 CAGGGTCGGAGGGCGGCGGCAGG + Intronic
1152232902 17:79123787-79123809 TAGCCCCTGAAGGCGGGGGCTGG - Intronic
1152509590 17:80776940-80776962 CAGGAAGTGAAGGGGGAGGCCGG + Intronic
1154036524 18:10808160-10808182 CAGGCACTCAAGGCTGCAGTGGG - Intronic
1155038703 18:22046957-22046979 TAGGCACTGGAGGGGGCAGCTGG - Intergenic
1155209205 18:23586463-23586485 CAGGCGCTGACCGCGGCAGCAGG + Exonic
1157701299 18:49762825-49762847 CAGGCCCTGAAGGCGCAGGCAGG - Intergenic
1157709647 18:49841386-49841408 CAGACAGTGAAGAAGGCGGCAGG + Exonic
1157826168 18:50814362-50814384 CAGCCAGTGAAGGTGGGGGCGGG + Intronic
1160500985 18:79400914-79400936 AAGGGCCAGAAGGCGGCGGCAGG - Intronic
1160707904 19:538286-538308 CAGGTACAGAAGGCGCCGGTAGG - Intronic
1160963515 19:1735262-1735284 GAGGCCCTGAAGGCCTCGGCAGG - Intergenic
1161215913 19:3094976-3094998 CAGGCAGTGAAGGCACAGGCAGG - Intronic
1162315130 19:9934274-9934296 GAGGCACTGCAGCCCGCGGCAGG + Intronic
1163667551 19:18610407-18610429 CAGGCACTGGAGGCGGGACCTGG + Intronic
1165274105 19:34733465-34733487 CAGGCTCTGATGGCTGCGGGAGG + Intergenic
1165436315 19:35797311-35797333 GAGGCTCTGAAGGCTGCGGTGGG + Intergenic
1166259045 19:41625384-41625406 CAGACACTGATGGCGGGGGCGGG - Intronic
1166375160 19:42323861-42323883 CGGGCGCTGGGGGCGGCGGCGGG - Intronic
1166871320 19:45872758-45872780 CAGGGGCTGGAGGCGGGGGCTGG - Exonic
925053525 2:835905-835927 AATGCACTGAAGGCCGAGGCGGG - Intergenic
925192065 2:1892814-1892836 CAGGCCCAGAAGGTGGCTGCCGG - Intronic
925215050 2:2087146-2087168 GAGAAACTGAAGGCAGCGGCAGG - Intronic
925276859 2:2656287-2656309 CAGACAATGAAGACGGTGGCAGG + Intergenic
925774865 2:7325040-7325062 AAGGCGTTGAGGGCGGCGGCAGG + Intergenic
926154867 2:10448209-10448231 CAGGCGCTGACGGGCGCGGCGGG - Exonic
927985756 2:27409412-27409434 TAGGCACCCATGGCGGCGGCTGG + Exonic
931429079 2:62195647-62195669 CCAGCACTGGAGGGGGCGGCCGG + Intergenic
933458088 2:82542350-82542372 CAGGCACTGAGGAAGGTGGCTGG + Intergenic
933937457 2:87217915-87217937 CAGGCACTGATGGCGGCGATCGG + Intergenic
934936669 2:98470516-98470538 CAGGCACTGAAGGAGCAGGAAGG + Intronic
936008391 2:108909578-108909600 CAGCCACTGCAGGCTGCGCCTGG - Intronic
936355684 2:111747887-111747909 CAGGCACTGATGGCGGCGATCGG - Intergenic
938246590 2:129782018-129782040 CAAGCACTCAAGGAGGGGGCTGG - Intergenic
939630761 2:144524213-144524235 CAGGGACCGAAGCTGGCGGCGGG - Intronic
940107937 2:150118844-150118866 CAGGGACTGGAGGCTGAGGCAGG + Intergenic
941713200 2:168736574-168736596 CAGGCACTGGAGGCTGAGGCAGG - Intronic
946066704 2:216994177-216994199 CAGGCCCTGAAGGCTGAGGGTGG - Intergenic
947792637 2:232876818-232876840 CAGGCAGAGGAGGCGGCGCCGGG - Intronic
948301350 2:236909535-236909557 CAGGTAGTGTAGGCCGCGGCAGG + Intergenic
1171123109 20:22582421-22582443 CTGGCGCTGAAGGAGGCCGCAGG - Exonic
1171217532 20:23362763-23362785 CAGGCACTGGAGGTGGCGACAGG - Intronic
1173059687 20:39649930-39649952 CAGGTCCTGAAGGCTGGGGCTGG + Intergenic
1174736912 20:52973312-52973334 CAGGCACCCAAGCGGGCGGCAGG + Exonic
1174806584 20:53608769-53608791 CAGCGGCTGAGGGCGGCGGCAGG - Intronic
1174898483 20:54475258-54475280 CAGGGGCTGAAGGGGGAGGCGGG + Intergenic
1175198621 20:57263598-57263620 CAGGCTCTGAAGGCAGCCACTGG + Intronic
1175225392 20:57441311-57441333 CAGGCTCAGACGGCGGCAGCTGG + Intergenic
1178641924 21:34351809-34351831 CAGCCACTGCAGGCAGCGGAGGG + Intergenic
1179730077 21:43362735-43362757 CATGCACTCAGGGAGGCGGCTGG + Intergenic
1180782544 22:18529180-18529202 CAGGCCCTGAAGGCGTGGGCGGG + Intronic
1181052121 22:20242894-20242916 CAGGCACGGAAGCTGGCAGCTGG + Exonic
1181126096 22:20703209-20703231 CAGGCCCTGAAGGCGTGGGCGGG + Intergenic
1181239435 22:21468518-21468540 CAGGCCCTGAAGGCGTGGGCGGG + Intergenic
1183323939 22:37181197-37181219 CAGTCACTGAGGGCAGGGGCAGG + Exonic
1183369532 22:37424664-37424686 TAGCCACTGAGGGCGGCGGGGGG + Intronic
1183430479 22:37762742-37762764 CAGGCACGGGAGGAGGCGGATGG + Intronic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
949416089 3:3815366-3815388 AAGGCACTGAGGGCAGTGGCAGG - Intronic
950549025 3:13655318-13655340 CAAGGGCGGAAGGCGGCGGCCGG - Intergenic
953464358 3:43105914-43105936 CTGGCGCTGGGGGCGGCGGCGGG - Exonic
954660346 3:52223738-52223760 CAGGCACTGGAGGTGGCCCCGGG - Exonic
955222770 3:57037012-57037034 CCGGCACTGGAGGCAGTGGCTGG - Intronic
956675105 3:71725505-71725527 CAGGCCCTGAAGGCGGCGGGCGG - Intronic
957118396 3:76057217-76057239 CAGGCACTGCAGGCTGTGGGTGG - Intronic
961689540 3:128658626-128658648 CAGGCTCTGGAGGCTGAGGCAGG + Intronic
962949924 3:140208926-140208948 CAGACAGTGAAGGTGGCGGTGGG - Intronic
964484663 3:157175090-157175112 CAGCCACTGCATCCGGCGGCCGG + Intergenic
966831966 3:184017648-184017670 CAGGCCTAGGAGGCGGCGGCAGG + Intronic
968726078 4:2248383-2248405 CAGGCACTGGAGGGTGGGGCAGG + Exonic
969182202 4:5450870-5450892 CAGGCACTGAGAGCAGAGGCTGG + Intronic
970599234 4:17627715-17627737 CAGGCACAGGAGGCTGAGGCAGG + Exonic
972634851 4:40874494-40874516 AAGGCACAGGAGGCGGGGGCAGG + Intronic
977694199 4:99949161-99949183 CAGGCCCTGAACGCGGCGAGAGG - Intronic
983077486 4:163343883-163343905 CAGGACCTGGAGGCGGCGGTGGG - Intronic
985991408 5:3565125-3565147 CTGGCACTGAGGGAGGCTGCAGG - Intergenic
992259380 5:74954382-74954404 CAGACACAGAAGGTGGCTGCTGG - Intergenic
994190440 5:96863148-96863170 CAGGGAGTGAAGGTGGGGGCAGG - Intronic
995527082 5:113058785-113058807 CAGGCCCTGAAGCAGGCAGCTGG + Intronic
999604330 5:153297666-153297688 CAGGCACTGCAGGCTGAGGCAGG + Intergenic
999609424 5:153353022-153353044 CAGGCACTGAAGTCTGTGGTTGG + Intergenic
1001294441 5:170489175-170489197 CAGGCACTGAAGGAAGAGGTAGG + Intronic
1001590453 5:172861057-172861079 CAGGCCCTGCAGGCTGGGGCAGG - Intronic
1002328561 5:178426057-178426079 AAGACACTGAAGGAAGCGGCAGG - Intronic
1002407096 5:179043498-179043520 CAGGCACAGAGGGAGGTGGCGGG - Intergenic
1008525560 6:52403754-52403776 CAGCCACAGAAGGCAGCTGCTGG - Exonic
1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG + Intergenic
1010204987 6:73314748-73314770 CAGGCACTGGGCCCGGCGGCGGG + Intergenic
1011354076 6:86455422-86455444 CAGTTACTGAAGGCTGTGGCAGG + Intergenic
1017946547 6:159100712-159100734 CAGGCAGTGGAGGCAGAGGCAGG + Intergenic
1017946709 6:159101930-159101952 CAGGCAGTGGAGGCAGAGGCAGG + Intergenic
1019357320 7:587476-587498 CAGGCCCTGGAGGCGGGGCCAGG - Intronic
1019711450 7:2519942-2519964 CGGGCAGTGGAGGCGGCGGCGGG - Exonic
1020461724 7:8435232-8435254 CTCGGACTAAAGGCGGCGGCTGG - Intronic
1022456728 7:30564380-30564402 CAGGCACTGAAGGCTTCTGGAGG + Intergenic
1022507685 7:30916701-30916723 CAGGCACTGAAAGGAGCTGCTGG - Intronic
1023654524 7:42406543-42406565 CAGGTACCGAAGGCGGCGCCGGG + Intergenic
1023907838 7:44534714-44534736 CAGGCACTGAGGGTGCCTGCCGG - Intronic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1027700809 7:81468215-81468237 CTGGGACTGAAGGCGGGGGTGGG + Intergenic
1029596887 7:101542723-101542745 AAGGGACTGAAGGCTGCGGGAGG + Intronic
1030699347 7:112621661-112621683 CCGGCACTGAAGGAGGGGTCTGG + Intergenic
1034237242 7:149581820-149581842 CAGGCACTGAAGACAGAGCCTGG + Intergenic
1034423076 7:150999278-150999300 CAGCCACTGAAGGGGGCTGCGGG - Exonic
1035709499 8:1701397-1701419 CCGGCTCTGAGGGCGGAGGCCGG + Exonic
1036593420 8:10190392-10190414 CAGGCACTGACGGGGGCAGGAGG - Intronic
1037330033 8:17735295-17735317 CAGCCTCTGAAGGCGGCGGTTGG + Intronic
1037998889 8:23373765-23373787 CAGGATCTGAAGGTGGTGGCAGG + Intronic
1038327036 8:26579170-26579192 CAGACAATGATCGCGGCGGCCGG + Intronic
1048722320 8:137340042-137340064 CAGGCACTGAAGGAGGCCAAGGG + Intergenic
1049197970 8:141325806-141325828 CAGCCACAGAAGGCGGGGGTGGG + Intergenic
1049487041 8:142871154-142871176 CAGGCCCTGAAGGATGCTGCTGG + Intronic
1049670859 8:143869277-143869299 CAGGCCGAGAGGGCGGCGGCCGG - Exonic
1049803052 8:144527068-144527090 CAGGCACTGGCGGCGGGCGCGGG - Exonic
1053426918 9:38016243-38016265 CAGGAACTAAAGCCGGCGCCCGG + Intronic
1057494848 9:95553040-95553062 CAGGCACAGCAGGCTGGGGCCGG + Intergenic
1060405022 9:123368788-123368810 CAGGCTCCGAAGGAGGCAGCTGG + Intronic
1062322607 9:135997810-135997832 CAGGAACAGAAGGCAACGGCCGG - Intergenic
1062609642 9:137368238-137368260 CAGGGACTCAAGGGGGTGGCTGG + Intronic
1187067448 X:15854677-15854699 CAGGGACTTACGGCGGCCGCGGG + Exonic
1190122749 X:47676066-47676088 CAGGCACAGAGGGAGGCGGGGGG + Intergenic
1190145626 X:47889443-47889465 CAGGCCCTGAAGGCACAGGCTGG + Intronic