ID: 1093958826

View in Genome Browser
Species Human (GRCh38)
Location 12:25251052-25251074
Sequence CGGTGTGGGAAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 873
Summary {0: 1, 1: 0, 2: 13, 3: 85, 4: 774}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093958812_1093958826 27 Left 1093958812 12:25251002-25251024 CCGCGCTCGATTCTTCTTCAGAC 0: 1
1: 0
2: 0
3: 0
4: 56
Right 1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG 0: 1
1: 0
2: 13
3: 85
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093958826 Original CRISPR CGGTGTGGGAAGAGGGAAGA GGG Intergenic
900619451 1:3580242-3580264 AGGGGTGGGAGGAGGGAAGGTGG + Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901778241 1:11575406-11575428 GGCTGTGGGAAGGGGGAAGGAGG - Intergenic
902036622 1:13462749-13462771 CTGATTGGGAAGAGGGAAGGAGG + Intergenic
902490816 1:16779324-16779346 GGGAGTGGGAAGAGGGTAGGAGG + Intronic
903011316 1:20332662-20332684 GGGAGTGGGAGCAGGGAAGAGGG - Intronic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904013965 1:27406300-27406322 TGATGTGTAAAGAGGGAAGAGGG + Exonic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904340360 1:29830175-29830197 GGGTGGAGGAAGGGGGAAGAAGG + Intergenic
904455864 1:30647733-30647755 GGGTGGAGGAAGGGGGAAGAAGG - Intergenic
904487102 1:30833051-30833073 AGGAGTGGGAAGTGGGAAGATGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904896301 1:33820831-33820853 TGGTGTGGGACGAGGGAAGCAGG - Intronic
904985415 1:34543908-34543930 GGGGGTGGGAAGAGGGGATATGG + Intergenic
905136954 1:35807757-35807779 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
905240213 1:36576376-36576398 GGGGGTGGGGTGAGGGAAGAAGG + Intergenic
905256622 1:36688971-36688993 GGGTGTGGGAAGGGGAAGGAAGG + Intergenic
905695932 1:39973446-39973468 CGGGGTGGGACGGGTGAAGAGGG + Intergenic
905947621 1:41917286-41917308 GGGGGAGGGAAGAGGAAAGAGGG - Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907442203 1:54486084-54486106 CTGTGTGGGAATAGGGATTAAGG - Intergenic
907866269 1:58402309-58402331 GGGTGTTGGGAGAGGGGAGAAGG - Intronic
909481174 1:76130183-76130205 CTGTGTGGGAACAGGGACTATGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909831471 1:80196676-80196698 AGGTGTGGGAAAAGGGAAGGTGG + Intergenic
910088342 1:83431286-83431308 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
910274271 1:85431546-85431568 AGGTGAGGAAGGAGGGAAGAAGG - Intronic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
912011265 1:104966550-104966572 AGGGAAGGGAAGAGGGAAGAGGG - Intergenic
912802404 1:112728384-112728406 GGAAGAGGGAAGAGGGAAGAGGG - Intergenic
912802406 1:112728391-112728413 AGGAGAGGGAAGAGGGAAGAGGG - Intergenic
914976651 1:152370576-152370598 CGGGGTGGGGGGAGGGAGGAGGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915300857 1:154950901-154950923 GGGCCTGGGCAGAGGGAAGATGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915548780 1:156619546-156619568 TGTTGTGGGGAGAGGGGAGATGG + Intronic
915624402 1:157105992-157106014 CTGGGTGGGAAGTGGAAAGAAGG - Intergenic
915939889 1:160112350-160112372 CGGGGCGGGAGGAGGGACGATGG + Intergenic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916320682 1:163499795-163499817 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
916419537 1:164623349-164623371 TGGTGTGGGAATGGGGGAGATGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917238133 1:172916895-172916917 GGGTGATGGAAGATGGAAGATGG - Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
918624730 1:186644356-186644378 GGGTGTGGGCAGTGGGTAGATGG + Intergenic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
919197119 1:194300220-194300242 AGGTGGGGGAAATGGGAAGATGG + Intergenic
919678425 1:200409732-200409754 AGGAGGAGGAAGAGGGAAGAGGG + Intronic
920232365 1:204479253-204479275 GGGTGAGGGAAGAGGGGAGGAGG - Intronic
920506996 1:206522282-206522304 AGATGTGGAAAGAGGGGAGACGG + Intronic
921262927 1:213399770-213399792 CGCTGTGGGAAGAAGGGAGCTGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
922290900 1:224208154-224208176 CGGGTTGGGCCGAGGGAAGAGGG + Intergenic
922775691 1:228213363-228213385 CGGGGTGGGAAGGGGGAAATTGG - Intronic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923482518 1:234397603-234397625 AGGTGGGGGAAGAGGGGAGGAGG + Intronic
923482529 1:234397623-234397645 AGGTGGGGGAAGAGGGGAGGGGG + Intronic
923529628 1:234803211-234803233 GGGAGTGGGAAGAGGGTAGGAGG - Intergenic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
924467423 1:244311198-244311220 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1062917857 10:1255648-1255670 CGGTGAGGTTAGAGGTAAGAGGG + Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1064586029 10:16840068-16840090 GGGTGGGGGAAGAGGGGAGGGGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065202928 10:23331297-23331319 AGGGAAGGGAAGAGGGAAGAGGG + Intronic
1065373741 10:25016225-25016247 CGCTGCAGAAAGAGGGAAGAGGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1067456185 10:46420899-46420921 GGGGTGGGGAAGAGGGAAGAAGG + Intergenic
1067631014 10:47963740-47963762 GGGGTGGGGAAGAGGGAAGAAGG - Intergenic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1067911935 10:50355274-50355296 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1068947364 10:62742970-62742992 CGGTGCAGGAAGAGAGGAGAGGG - Intergenic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069138421 10:64794343-64794365 AGGTGTTGAAGGAGGGAAGAAGG + Intergenic
1069184074 10:65400468-65400490 TGGTGGGGGAAGGGGGAAGGAGG - Intergenic
1069772544 10:70908774-70908796 TGGACTGGGAAGAGGGCAGACGG - Intergenic
1069917324 10:71795703-71795725 CGGGGTGGGAGGAGGGAGGGAGG - Intronic
1070361839 10:75698165-75698187 TGGGGTGGGAACAGGGAGGAAGG - Intronic
1070433500 10:76364590-76364612 GGGCATGGGAAGAGGGAAAAAGG + Intronic
1070496481 10:77028522-77028544 TGGGTTGGGAAGAGAGAAGAAGG - Intronic
1070895653 10:79981670-79981692 GGCTGTGGGAAGAGGGAAGGTGG + Intronic
1071099341 10:82017075-82017097 TGGGGTGGGGAGAGGGGAGAGGG - Intronic
1071155800 10:82687580-82687602 TGGTTTGGGAAGATAGAAGAGGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071697285 10:87890004-87890026 AGGTGGGGGAAGCGGGAGGATGG - Intronic
1071949340 10:90684809-90684831 TGGGGTGGCATGAGGGAAGAGGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073046123 10:100639566-100639588 AGGAGTGGGAAGAGCGGAGAAGG + Intergenic
1074001057 10:109373243-109373265 TGTTGTGGGGTGAGGGAAGAGGG + Intergenic
1074022935 10:109603222-109603244 CGGAGAGGGAAGAGGGCAGCAGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075303672 10:121348502-121348524 AGGTGGGGCAAGGGGGAAGAGGG - Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075412768 10:122241203-122241225 TGGTGTGGAAGGAGGTAAGATGG + Intronic
1075984279 10:126770189-126770211 AGATGTGGGGAGAGGGAAGATGG - Intergenic
1075987894 10:126803813-126803835 CGGTGAGGGGAAAGGGAAGGAGG - Intergenic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076160971 10:128243962-128243984 CGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1076347980 10:129793800-129793822 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077423348 11:2463086-2463108 GGGTGTGGGGAGTGGGAAGTGGG + Intronic
1077660534 11:4064678-4064700 GGAAGAGGGAAGAGGGAAGAGGG + Intronic
1078187204 11:9062158-9062180 AGTTGGGGGAAGAGGGATGAGGG - Intronic
1079232867 11:18664756-18664778 TGGGGTGGGAGGAGGGGAGAGGG + Intergenic
1080132665 11:28815096-28815118 GGGTGAGGAAAGAGGGGAGATGG - Intergenic
1080216380 11:29846359-29846381 CGGGGTGGGGATGGGGAAGAGGG - Intergenic
1081282868 11:41231615-41231637 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082195698 11:49302232-49302254 TGGTGAGGGATGAGGGAAGGAGG - Intergenic
1082617547 11:55379265-55379287 TGGGGTGGGAGGAGGGGAGAGGG + Intergenic
1082629572 11:55526147-55526169 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083798951 11:65035213-65035235 CGGGGTGGGAGGAGGGAACCAGG + Intronic
1084406779 11:68978935-68978957 AGGTGAGGGAGGAGGAAAGACGG - Intergenic
1084490664 11:69476566-69476588 CGGGCTGGGGAGAGGGAAGGGGG - Intergenic
1084580439 11:70019925-70019947 CGGAGTGGGAAGGGGGCCGAGGG + Intergenic
1084706223 11:70817375-70817397 AGGGGTGGGGAAAGGGAAGATGG + Intronic
1084859125 11:72006769-72006791 AGGTTTGGGAGGAGGGGAGAGGG - Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085392672 11:76190404-76190426 GGGGGTCGGCAGAGGGAAGATGG - Intronic
1085780376 11:79402695-79402717 AGGTTGGGGAAGAGGGAAGTAGG - Intronic
1086862643 11:91943429-91943451 TGCTGTGGGATGACGGAAGATGG - Intergenic
1087052034 11:93896096-93896118 CGGGGTGGGATGAGCAAAGAGGG - Intergenic
1087566533 11:99866869-99866891 TGTTGTGGGAAGGGTGAAGAGGG - Intronic
1087930011 11:103966190-103966212 GGGTGGAGGAAGAGGGAAGAAGG + Intronic
1088892397 11:114055374-114055396 GGGTGGGGGATGAGGGATGATGG + Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1089742111 11:120591598-120591620 GGTGGAGGGAAGAGGGAAGAAGG - Intronic
1090209957 11:124912030-124912052 AGGTGTGGGATGATGGTAGAAGG - Intergenic
1090612537 11:128484297-128484319 CGGTTTGGGAAGATACAAGATGG - Intronic
1090709448 11:129372794-129372816 GGGTTTGGAAAAAGGGAAGAAGG + Intergenic
1091228154 11:133970547-133970569 CTGTGAGTGAAGAGTGAAGATGG - Intergenic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1091446390 12:546216-546238 GGGTGTGGGAGGAGGGGAGTGGG + Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091707428 12:2705479-2705501 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1092030641 12:5280941-5280963 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
1092253238 12:6913075-6913097 AGGTAGGGGAAGAGGCAAGAGGG + Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1093091296 12:14924006-14924028 TGGTGATGGAAGAGGGAAGAGGG - Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094719225 12:33045952-33045974 AGCTGTGGGAAAAGGGAAGGTGG - Intergenic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1096148164 12:49293416-49293438 GGGAGTGGGAAGCGGGAGGAAGG - Intronic
1096523179 12:52195442-52195464 GGGTGGGGGCAGAGGGAACAGGG + Intergenic
1096693725 12:53335974-53335996 AGGGGTGGGAAGCAGGAAGAGGG + Intronic
1096828036 12:54294405-54294427 CTGTGTGGGAAGAGGGCCTAGGG + Intronic
1096868728 12:54580066-54580088 TGCTGTGGGAAGAGAGATGAGGG - Exonic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097188744 12:57209556-57209578 CGGTGTGGGGAGAGAGAATTTGG + Intronic
1097238005 12:57552775-57552797 AGGTGCGGGAAGAGTGAAGGTGG + Intronic
1097244452 12:57599461-57599483 GGGTGAGGGATGAGGGATGAGGG + Intronic
1097324483 12:58260333-58260355 TGGTGTGAGAAGAGGGCAAAGGG - Intergenic
1097357366 12:58616639-58616661 TGGCATGGGAAGAGAGAAGAGGG + Intronic
1097730128 12:63119163-63119185 TGGGTTGGGAAGAGAGAAGACGG + Intergenic
1097901562 12:64878690-64878712 GGGTGAAGGAAGAAGGAAGAAGG - Intronic
1098394401 12:70002992-70003014 CGGTGTGGGAAGAGGGCCAAGGG + Intergenic
1098454184 12:70653447-70653469 GGGTGTGGTAAGAGGGAAGCAGG + Intronic
1098773250 12:74581777-74581799 CGTTTTTGGAAGAGGGAGGAGGG - Intergenic
1100774111 12:97955669-97955691 AGGGGTGGGAAGAGGGGAGTGGG + Intergenic
1101088956 12:101265245-101265267 TGTTGTGGGATGAGGGATGAGGG - Intergenic
1101288268 12:103338815-103338837 AGGAGTGGGAACAGGAAAGAAGG + Intronic
1101504836 12:105336704-105336726 AGATGTGGGATGAAGGAAGAGGG + Intronic
1101835137 12:108289658-108289680 AAATGTGGGAAGAGGGGAGATGG + Exonic
1101932018 12:109022380-109022402 GGGTGGGGGAAGTTGGAAGAGGG + Intergenic
1102290141 12:111692674-111692696 CTGTGTGGGAAGAAGGCACAGGG - Intronic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102899319 12:116624071-116624093 AGGTGAAGGAAGAAGGAAGAAGG + Intergenic
1102901997 12:116646167-116646189 TGGTGGGGGAGGAGAGAAGAAGG + Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1103229345 12:119315093-119315115 AGGTGGGGGAAGGAGGAAGAGGG - Intergenic
1103364426 12:120370902-120370924 TGGGGTGGGGAGAGGGAAGGAGG - Intergenic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104178116 12:126352059-126352081 GGGTCAGGGAAGAGGGAGGATGG + Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104636186 12:130439011-130439033 CGGTCCGGGCAGAGGGTAGAGGG - Intronic
1104976764 12:132555644-132555666 AGGAGTGGGAAGAGGCAGGAAGG - Intronic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1105428116 13:20313177-20313199 CTGAGTGGGATGAGGGATGAAGG + Intergenic
1105453198 13:20518469-20518491 CGGTGGGGGGAGAGGAAGGAGGG + Intronic
1105638125 13:22235919-22235941 TGGTTTGAGACGAGGGAAGAGGG - Intergenic
1107195740 13:37649365-37649387 AGGAGTGGGAAGAGGTACGAAGG - Intronic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1108052478 13:46460226-46460248 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1108322786 13:49303794-49303816 GCGTGTGGGAGGAAGGAAGAGGG - Intergenic
1108447802 13:50526854-50526876 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
1108447804 13:50526861-50526883 GGGAGAGGGAAGAGGGGAGAAGG + Intronic
1109260424 13:60138787-60138809 GGAAGAGGGAAGAGGGAAGAGGG + Intronic
1109260426 13:60138794-60138816 GGAAGAGGGAAGAGGGAAGAGGG + Intronic
1109260428 13:60138801-60138823 GGAAGAGGGAAGAGGGAAGAGGG + Intronic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1109538793 13:63745876-63745898 TGGAGTGGGGAGAGGGGAGAGGG + Intergenic
1109545042 13:63833890-63833912 TGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1109704859 13:66077011-66077033 GGGTGTGGGAAAATGGTAGAAGG + Intergenic
1109995927 13:70125903-70125925 GGTTGTGGGAGGAGGGCAGAGGG + Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110528717 13:76571538-76571560 AGGTGGGGGAAAAGGGAAAAGGG - Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111000750 13:82177196-82177218 GGGTGTGGGAATGGGGATGAGGG + Intergenic
1113552256 13:111201782-111201804 CGGTGCTGGAAGAAGGAAGAGGG - Intronic
1113776732 13:112951969-112951991 TGAAGTGGGAAGAGGGAAAAGGG + Intronic
1113799252 13:113078029-113078051 TGGTGCGGGAAGGGGGAGGACGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114814243 14:25937751-25937773 GGGTGTGGGAAGTGGAAGGAGGG + Intergenic
1114979904 14:28149647-28149669 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1115539951 14:34411251-34411273 GGGAGAGGGAAGAGGGGAGAGGG - Intronic
1115539954 14:34411258-34411280 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1116402160 14:44521243-44521265 CAGTGTGGGAAGAGTGACTAGGG + Intergenic
1117884572 14:60346889-60346911 AGGTGTGGAAAGAGGGAAATGGG - Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118592072 14:67409584-67409606 GGGAGTGGGGAGAGGGAAGTGGG - Intronic
1118780526 14:69004835-69004857 AGCTGGGGGAAGAGGGAGGAGGG - Intergenic
1119193394 14:72699932-72699954 AGCTGTGGGAGGAGGAAAGAGGG + Intronic
1119217035 14:72876926-72876948 GGGAGTGGGGAGAGGGAAGGAGG - Intronic
1119474222 14:74917924-74917946 TGCTGTGGGAAGCGGGAAGTGGG + Intronic
1119507150 14:75182772-75182794 GGGTGGGGGAAGAGGGGAGAAGG - Intergenic
1119878594 14:78081422-78081444 AGGTGAGGGAACAGTGAAGAGGG + Intergenic
1120045138 14:79797313-79797335 AGGAGTAGGTAGAGGGAAGAGGG + Intronic
1120647233 14:87088617-87088639 GGGTGGGGGAAGTGGGAAGTGGG + Intergenic
1120846879 14:89133998-89134020 TGGTGTGGGAGGAGGTAAGTAGG - Intronic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121241892 14:92436877-92436899 GGGTGTGGGTAAAGGGGAGAAGG - Intronic
1121305537 14:92904224-92904246 AGGTGTGGGAAGAGGCCAGAGGG + Intergenic
1121489091 14:94345049-94345071 GGGGCTGGGGAGAGGGAAGATGG + Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121505377 14:94473126-94473148 TGGTGGGGGAAGGGGGAAGGAGG - Intronic
1121773295 14:96572155-96572177 TGATATGGGAAGAGGTAAGATGG + Intergenic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1121970634 14:98352884-98352906 GGGGGTGGGATGGGGGAAGAGGG - Intergenic
1122238033 14:100344063-100344085 GGGAGAGGGAAGAGGGAAGAGGG - Intronic
1122389892 14:101373082-101373104 CGGTGTGGGAAGAGGGTTCCAGG + Intergenic
1122392797 14:101401839-101401861 AGAAGAGGGAAGAGGGAAGAGGG - Intergenic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1124010023 15:25830643-25830665 CAGTGAGGGAAGACGGAAGGGGG - Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126800436 15:52293197-52293219 CCCTGTGGGAACAGGGAAGAGGG - Intronic
1127062084 15:55196967-55196989 CGGTCGGGGAAGGGGGAAGAAGG - Exonic
1127827287 15:62715861-62715883 AGGTGGGGACAGAGGGAAGAGGG - Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128867274 15:71123739-71123761 AGGTTGGGGGAGAGGGAAGAGGG + Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129044886 15:72725784-72725806 GGATGGGGGAAGAGGGAAGGAGG - Intronic
1129115922 15:73365458-73365480 GGGTGTGGGGATAGGGAAGCGGG - Intronic
1129254181 15:74324886-74324908 TGGAGTGGGAAGGAGGAAGAGGG - Intronic
1129324538 15:74793262-74793284 GGGTCTGGAAACAGGGAAGAGGG - Intronic
1129450320 15:75647837-75647859 AGGGGTGGGGAGAGGGAGGAGGG - Intronic
1129677916 15:77642379-77642401 TGGTGTGGGGAGAGGGAGAAAGG + Intronic
1129783375 15:78289998-78290020 TGGTGTGGAAAGTGGGAAAAAGG - Exonic
1130085423 15:80774812-80774834 AGGGCTGGGAAGATGGAAGAGGG - Intergenic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1131642532 15:94307770-94307792 GGCTGTGGGCAGAGGGAAAATGG + Intronic
1131675294 15:94665095-94665117 TGGGGTGGTAACAGGGAAGACGG - Intergenic
1132113794 15:99121054-99121076 TGGTGGGGGAAGTGGGGAGATGG + Intronic
1132485714 16:189803-189825 AGGTGTGGGAAGAGGCGAGAGGG - Intronic
1133313967 16:4870670-4870692 CGGGAGGGGAAGAGGCAAGACGG - Intronic
1133392816 16:5422976-5422998 AGGAGTGGGGAGAGGGAGGAGGG + Intergenic
1133392837 16:5423036-5423058 AGGAGTGGGGAGAGGGAAGAGGG + Intergenic
1133774057 16:8884296-8884318 GGGAGTGGGAAGCGGGAAGCAGG - Intergenic
1134233879 16:12450585-12450607 CGGTGTGAGAGAAGGGAAGACGG + Intronic
1134313974 16:13101110-13101132 GGCTGTGGGGAGAGGGAAGTGGG + Intronic
1134323365 16:13184158-13184180 TGGTTTGGGAAGAGGCAGGATGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134839485 16:17390345-17390367 CGGGGTGGGGAGTGGTAAGAAGG + Intronic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135627263 16:24006836-24006858 GGGGGTGGGGAGGGGGAAGAAGG + Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1136054496 16:27678405-27678427 AGGAGAGGGAAGAGGGGAGATGG - Intronic
1136155619 16:28380210-28380232 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136155637 16:28380261-28380283 CGGGGTGGGAAGCGGGCAGGTGG - Intronic
1136207447 16:28735028-28735050 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136207465 16:28735079-28735101 CGGGGTGGGAAGCGGGCAGGTGG + Intronic
1136552652 16:30989819-30989841 AGGGGTGGGAACAGGGAGGAGGG + Exonic
1137032254 16:35534178-35534200 AGGAGTGGGAACAGGAAAGATGG + Intergenic
1137841213 16:51642575-51642597 AGGGGTGGAAAGAGGGAAAAGGG - Intergenic
1138189047 16:54999403-54999425 TGGAGTGGGGAGAGGGCAGAAGG - Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138450981 16:57093202-57093224 AGGGGTGGGAGGAGGGCAGAGGG - Intronic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1140477661 16:75247086-75247108 AGGTGGGGGCAGAGGGGAGAAGG - Intronic
1141025225 16:80540800-80540822 CCGGGAGGGAAGAGGGAAGTGGG - Intronic
1141042085 16:80681348-80681370 AGGTTAGGGAAGAGGGTAGAAGG + Intronic
1141152720 16:81575343-81575365 TGGTGTGGGGAGAGAGAGGAAGG - Intronic
1141155471 16:81593927-81593949 AGGTAAGGGTAGAGGGAAGAGGG - Intronic
1141480552 16:84303822-84303844 GGCTGCGGGAAGAGGGAAGGAGG - Intronic
1141623654 16:85250179-85250201 TGGTGTGGGCAAGGGGAAGAGGG - Intergenic
1141667773 16:85474704-85474726 GGGAGTGGGGAGAGGGAGGAGGG - Intergenic
1141804648 16:86334706-86334728 GGGCCTGGGAGGAGGGAAGACGG + Intergenic
1141840940 16:86573664-86573686 GGGTGTGTGAAGAGGGAAGGGGG + Intergenic
1142178668 16:88656732-88656754 CCCTGTGGGAGGAGGGGAGAAGG - Intronic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142251449 16:88993779-88993801 GGGGGAGGGAAGAGGGAGGAGGG - Intergenic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142793421 17:2287886-2287908 GGTTGTGGGAAGAGAGAAGTGGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1142861922 17:2767462-2767484 GGTTGGGGGAAGAGAGAAGAGGG - Intergenic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1143016884 17:3895535-3895557 TGGTTGGGGAAGAGGGCAGAAGG + Intergenic
1143149155 17:4796709-4796731 TGGTCTGGGAAAAGGGAAAAAGG - Exonic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143370653 17:6436898-6436920 GGAGGAGGGAAGAGGGAAGAGGG + Intergenic
1143370655 17:6436905-6436927 GGAAGAGGGAAGAGGGAAGAGGG + Intergenic
1143474045 17:7192893-7192915 TGGGGTGGGGAGAGGGGAGAAGG + Intronic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144877698 17:18411047-18411069 TGGGGAGGGAGGAGGGAAGAGGG - Intergenic
1145154531 17:20533356-20533378 TGGGGAGGGAGGAGGGAAGAGGG + Intergenic
1145969576 17:28949298-28949320 CCGGGAGGGAGGAGGGAAGAGGG + Intronic
1146691863 17:34882399-34882421 GGGTGAGGGCAGAGGGAAGGGGG - Intergenic
1146804806 17:35856674-35856696 GGCTGTGGGAAGGGGGCAGAGGG - Intronic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1147032872 17:37655108-37655130 GGGTGTGGGGAGTGAGAAGAGGG + Intergenic
1147129702 17:38399877-38399899 AGGGGTGGGAGGAGGGAACAGGG + Exonic
1147183693 17:38702504-38702526 AGGTGCGGGAAGCGGGAAGCAGG + Intergenic
1147319849 17:39639574-39639596 GGGTGGGGGAACAGGGGAGACGG + Intronic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147583402 17:41639074-41639096 CGGTGGGGGAAGTGAAAAGAGGG - Intergenic
1147649464 17:42053799-42053821 CGGGCTGGGAAGTGGGGAGAGGG - Intronic
1148111770 17:45148542-45148564 AGCTGTGGGAAGGGGGAGGAGGG + Exonic
1148124888 17:45231444-45231466 AGGGCTGGGAAGTGGGAAGAGGG + Intronic
1148477822 17:47940961-47940983 CTGAATGGGAAGGGGGAAGAAGG - Intergenic
1148477829 17:47940984-47941006 CGGTGAGGTGAGAAGGAAGATGG - Intergenic
1148546185 17:48520745-48520767 TTCTGTGGGAAGTGGGAAGATGG + Intergenic
1148761403 17:50003594-50003616 CGGTGAGGCAAGAGGGTAGATGG + Intergenic
1150223105 17:63508152-63508174 GGGTGAGGGAAGAGGCAAGTGGG + Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150847280 17:68672283-68672305 AGGTTTGGGAACAGGGAATAAGG + Intergenic
1151052642 17:70995867-70995889 TGGAGAGGGAAGATGGAAGAAGG - Intergenic
1151327813 17:73389713-73389735 TGGGGAGGGGAGAGGGAAGATGG + Intronic
1151398003 17:73837355-73837377 TGGAGTGGGAAGAGGGAGGAGGG + Intergenic
1151453634 17:74213851-74213873 GGGTGGGGGAAAAGGGGAGAGGG - Intronic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152506441 17:80752220-80752242 TGTTGTGGGGAGAGGGGAGAGGG - Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1153530266 18:6039022-6039044 GGGTTGGGGAAGAGGGAGGAAGG - Intronic
1154098446 18:11444176-11444198 TGTTGTGGGGAGAGGGAAGGGGG - Intergenic
1154332239 18:13439716-13439738 GGGTGCAGGAAGAGGGAGGAAGG + Intronic
1154348668 18:13565291-13565313 CTGTCTGGGATCAGGGAAGATGG - Intronic
1155074297 18:22341547-22341569 TGGTGTGGGATGAAGGCAGAGGG - Intergenic
1155478406 18:26259424-26259446 CGGGGTGGGAGGAGGGGGGAGGG - Intronic
1155539124 18:26848727-26848749 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155865073 18:30954923-30954945 GGGTCTAGGAAGAGGCAAGAAGG - Intergenic
1155994077 18:32311721-32311743 TGGAGTGGGATAAGGGAAGAGGG + Intronic
1157242987 18:46028397-46028419 CGGCGAGGGAAGAGGAGAGACGG + Intronic
1157287462 18:46386819-46386841 TGCTGTGGGAAGAAGGAAGGAGG - Intronic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1158335493 18:56411876-56411898 TGGATTGGGAAGAAGGAAGACGG - Intergenic
1158519759 18:58162144-58162166 CTGTGAGGGAACAGGGCAGAAGG - Intronic
1158796882 18:60856949-60856971 CGGTGGGGGGAGAGGGGAGGAGG - Intergenic
1158882238 18:61791608-61791630 GGGTCTGGGAAGAGGGAGGGAGG - Intergenic
1159337942 18:67094460-67094482 AGGGGTGGGGAGTGGGAAGAGGG + Intergenic
1160866987 19:1260431-1260453 CGGGGTGGGAAGGAGGAAGGAGG + Intronic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1160988684 19:1851887-1851909 CCTAGTGGGAATAGGGAAGAGGG - Intergenic
1161062016 19:2219959-2219981 CCGCGTGGGAAGAGGGCAGCGGG - Intronic
1161520862 19:4722972-4722994 CTGTGTGGGAAGAAGGTAGGCGG + Intronic
1161638104 19:5401918-5401940 AGGGTTGGGAGGAGGGAAGAAGG + Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162299319 19:9835326-9835348 CGCTGCGGCAGGAGGGAAGATGG + Exonic
1162326411 19:10002284-10002306 GGGTGTGGGAAGAGGGTGGTGGG + Intronic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162826094 19:13253140-13253162 AGGGGTGGGAAGTGGGAAGTGGG + Intronic
1162874101 19:13608098-13608120 GGGAGTGGGAGTAGGGAAGAAGG - Intronic
1163404170 19:17112298-17112320 CGGGGTGGGAGGAAGCAAGAAGG + Intronic
1163492213 19:17623572-17623594 CGGTGGGGGAGGGGGGAATAAGG + Intronic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1164855450 19:31517368-31517390 TGCCGTGGGAAGAAGGAAGAAGG + Intergenic
1165427226 19:35752915-35752937 TGGTGGGGGAAGCGGGCAGATGG - Exonic
1165773084 19:38389499-38389521 CGGGAAGGGAAGAGGGAGGAAGG + Intronic
1165912353 19:39237104-39237126 AGGTGTGGGGAGAGGAGAGAGGG + Intergenic
1165913536 19:39244305-39244327 AGGTGTGGGGAGAGGAGAGAGGG + Intronic
1166142316 19:40811676-40811698 GGTTGTGGGAAGAGGGGAGCAGG - Intronic
1166185206 19:41135121-41135143 GGTTGTGGGAAGAGGGGAGCAGG + Intergenic
1166214278 19:41325431-41325453 CGGTGAGGGAGGAAGGCAGAGGG - Intronic
1166690955 19:44821010-44821032 GGGAGAGGGAAGAGGGAAGAGGG - Exonic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1167261963 19:48463828-48463850 TGGTGGGGGAAGAGGAGAGAGGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168184755 19:54692577-54692599 AAGGGTGGGAAGAGGGGAGAGGG + Intronic
1168259035 19:55182604-55182626 AGGTTTGGGAGGAGTGAAGAAGG - Intronic
925285458 2:2712797-2712819 TGAAGTGGGAAGAAGGAAGATGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925558982 2:5167264-5167286 GGGGGTGGGAAGCGAGAAGAGGG + Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
928087515 2:28355290-28355312 GGGTGTGGGCAGAGGGAATGGGG - Intergenic
928230239 2:29492462-29492484 AGGAGTGGGAAGAGGGAATCAGG + Intronic
928564906 2:32535444-32535466 TGGGGTGGGAGGAGGGGAGACGG - Intronic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
930270485 2:49250799-49250821 CGGTTTATGAAGAGAGAAGAAGG + Intergenic
930928547 2:56851705-56851727 AGGCGTGGGAGGAGGGAAGGAGG - Intergenic
931643823 2:64404188-64404210 TGGGGAGGGAGGAGGGAAGAGGG - Intergenic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932079504 2:68698940-68698962 GGATGTGGGAAGAGGAAAGTAGG - Intronic
932481558 2:72042426-72042448 TGGTGTGGTAAGAGGGATAAAGG + Intergenic
933022255 2:77208488-77208510 CTGAGTGAGAAAAGGGAAGAAGG + Intronic
933257738 2:80099814-80099836 CGGGGTGGAGAGATGGAAGATGG + Intronic
933689437 2:85168398-85168420 AAGTGTGGGAACAGTGAAGATGG + Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
935075949 2:99744040-99744062 GGGTGGGGGCAGAGGGCAGAAGG - Intronic
935204921 2:100889267-100889289 TGGTGTTCGAAGAGGGAAAATGG + Intronic
936058820 2:109281301-109281323 CGGGGAAGGAAGAGGCAAGAGGG - Intronic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
937210329 2:120264754-120264776 GGGTGGGGGAAGAGGGGAGTGGG - Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
938299308 2:130198853-130198875 CTGGGTGGGAACAGGGAAGAGGG - Intergenic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938457407 2:131475684-131475706 CTGGGTGGGAACAGGGAAGAGGG + Intronic
938729039 2:134131686-134131708 GGGTGGGGGAAGAAGGAAGGAGG - Intronic
938746981 2:134288835-134288857 AGGTGTGGGAGTAGGGGAGAGGG - Intronic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939135321 2:138286873-138286895 TGGGGTGGGAAGAGGGGAGAGGG - Intergenic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939606708 2:144262919-144262941 GGGAGAGGGGAGAGGGAAGAGGG + Intronic
939856661 2:147366757-147366779 GGGTGGGGGAAGGGGGGAGAGGG - Intergenic
940185562 2:150981146-150981168 AGGGGAGGTAAGAGGGAAGATGG - Intergenic
940268816 2:151869478-151869500 GGAAGAGGGAAGAGGGAAGAGGG - Intronic
941903927 2:170703298-170703320 TGGTTTGGAAAGTGGGAAGAGGG - Intergenic
942251844 2:174053901-174053923 CGGGGAAGGAAGAGGGGAGAGGG + Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942543022 2:177034456-177034478 AGATGAGGGAAGAGAGAAGACGG + Intergenic
943214213 2:185009819-185009841 AGGTGTGGAAAGAGGAAGGAAGG - Intergenic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944359218 2:198832298-198832320 CGATTTGGGAAGAGGTAATAGGG - Intergenic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
945188388 2:207163072-207163094 CGGTTTTGGGAGGGGGAAGAAGG + Intronic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945570105 2:211456679-211456701 GGATGTGGGAGGAGGGGAGAGGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946160244 2:217831431-217831453 TGAGTTGGGAAGAGGGAAGATGG - Intronic
946205343 2:218102746-218102768 TGGGGTGGGGGGAGGGAAGAGGG - Intergenic
946498746 2:220222794-220222816 AGGTGTGAGAAAAGGGTAGAAGG - Intergenic
947761086 2:232604454-232604476 AGCTGTGGGAAGTGGGAAGCTGG - Intergenic
947935780 2:234002218-234002240 AGGAGTGGGCAGAGGGAGGAGGG + Intronic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948762198 2:240199178-240199200 CGGTGGGGGAGGGGGGAAGCAGG - Intergenic
948951560 2:241255617-241255639 AGGTGTGGGAAGCGGGCAGGTGG + Intronic
1168798374 20:627570-627592 GGGACTGGGAAGAGGGGAGAGGG - Intergenic
1168975589 20:1963144-1963166 AGGGGTGGATAGAGGGAAGAAGG + Intergenic
1169087443 20:2836137-2836159 AGGGGTGGGAAGAGGGGAGGTGG + Exonic
1169368915 20:5013430-5013452 AGGTATGGGAAGACAGAAGAAGG + Intergenic
1169469472 20:5871723-5871745 AGGGGAGGGAAGGGGGAAGAAGG + Intergenic
1169715328 20:8610058-8610080 GGGTCTGGGAAGAGGAAGGAGGG - Intronic
1170030065 20:11935456-11935478 AGCTGTTGGAAGAGGGATGAAGG + Intergenic
1170095560 20:12642321-12642343 GGGTGTGGGAAGAGGAAGAAGGG + Intergenic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1171762620 20:29221380-29221402 CGTTGTGGGGTGAGGGGAGAGGG + Intergenic
1172608214 20:36230064-36230086 GGGTGGGGGAAGGGGGAAGGGGG - Exonic
1172656999 20:36543453-36543475 GGGTTTGGGCAGAGGGAAGAGGG + Intronic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1172805929 20:37611558-37611580 CGGGGTGGGAAGAGGTGAGGGGG - Intergenic
1174216536 20:48920844-48920866 TGGTGTGGGAAGAGGTGAGAGGG - Intergenic
1174749999 20:53102443-53102465 AGGTGGGGGAAGAGAGGAGAGGG + Intronic
1174894355 20:54433166-54433188 TGTTGGGGGAGGAGGGAAGAAGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176126958 20:63479890-63479912 CTGTGTGAGACCAGGGAAGAGGG - Intergenic
1176222396 20:63975829-63975851 CGGCCTGGGGAGAGGAAAGAGGG + Exonic
1176729584 21:10480001-10480023 TGGTGTGGTAAGAGAGATGATGG + Intergenic
1178372397 21:32037361-32037383 AGGTGGGGGAAGGGTGAAGACGG - Intronic
1179711995 21:43268810-43268832 CGGGTTGGGGAGAGGGAAGACGG + Intergenic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180616494 22:17131709-17131731 GGGTGTTGGAAGTGGGAAGATGG - Exonic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181463050 22:23096571-23096593 AGGTGGGGGCAGAGGGAACAGGG + Intronic
1181527871 22:23500465-23500487 CTGGGTGGGGAGAGGGAAGTGGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181602406 22:23960267-23960289 CGGTGAGGGGTGAGGGAAGGAGG + Intronic
1181606105 22:23981040-23981062 CGGTGAGGGGTGAGGGAAGGAGG - Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1182103750 22:27674534-27674556 AGGAGTGGGGAGAGGGAGGAAGG - Intergenic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1183073098 22:35409983-35410005 GGGTATGGGAAGAGGGGAGTTGG + Intronic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1184138243 22:42562024-42562046 GGGTGAGGGAACAGGCAAGAGGG + Intronic
1184537112 22:45094696-45094718 AGGGGGGGGAAGAGGGAGGAAGG - Intergenic
1184734841 22:46391954-46391976 GGGTGTGGGATGTGGGCAGAGGG - Intronic
1184961140 22:47929510-47929532 GGTTGTGGGGAAAGGGAAGAGGG + Intergenic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949551332 3:5114690-5114712 CGGAGAGGGGAGAGGGGAGAGGG + Intergenic
949748359 3:7322550-7322572 GGGTGGGGGAAGAGGGGTGAGGG - Intronic
949930191 3:9072318-9072340 GTGTGTGGGAACATGGAAGAGGG - Intronic
950085552 3:10254995-10255017 GGGAGTGGGAAGTGGGAAGGAGG - Intronic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950755092 3:15164178-15164200 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
951524840 3:23643944-23643966 AGGTGAGAGAAGAGGGAATACGG - Intergenic
951525975 3:23653162-23653184 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
952364527 3:32663434-32663456 GGAAGAGGGAAGAGGGAAGAGGG - Intergenic
952364529 3:32663441-32663463 GGGAGAGGGAAGAGGGAAGAGGG - Intergenic
953114327 3:39976891-39976913 CGTTGTGGGAGGAGGGGAGTGGG + Intronic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
953854651 3:46491955-46491977 AGGGGTGGGAGGAGGGAGGACGG - Intergenic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
953920680 3:46949278-46949300 CGGAGGGGGAAGAGAGCAGAGGG + Intronic
953980409 3:47410521-47410543 CGGTGGGGGCACAGGGAAGCAGG - Exonic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954345667 3:49996031-49996053 GGGTGTGGGAAGTGGGGAGGGGG - Intronic
954549351 3:51467499-51467521 TGGGGTGGGGAGAGGGGAGAGGG + Intronic
954683927 3:52360435-52360457 CAGTGTGGGAAGGAGCAAGAGGG - Intronic
954813461 3:53262383-53262405 GGAAGAGGGAAGAGGGAAGAAGG - Intergenic
954813462 3:53262390-53262412 AGGAGGAGGAAGAGGGAAGAGGG - Intergenic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
955650678 3:61190931-61190953 TGGGGTGGGGGGAGGGAAGAGGG + Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
956810725 3:72861691-72861713 TGCTGTGGGAAGAGAGAAGGAGG + Intronic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
957528021 3:81402717-81402739 GGGTGGGGGAAGTGGGGAGAGGG - Intergenic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957660076 3:83138633-83138655 TGGTGTGGGAGGAGGGGGGAGGG + Intergenic
959683592 3:109123331-109123353 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
960273419 3:115699357-115699379 TGGTGGGGGAAGAGGAAGGAAGG - Intronic
960909779 3:122637940-122637962 TGGGGTGGGGAGAGGGGAGAGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961348067 3:126277739-126277761 AGGTGTTGGAAGACAGAAGAGGG + Intergenic
961422411 3:126816853-126816875 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961472773 3:127126879-127126901 CTTTGTGGGAGAAGGGAAGAGGG - Intergenic
961587992 3:127950272-127950294 CAGGGAGGGAAGTGGGAAGAAGG + Intronic
961612613 3:128152971-128152993 CGGGGTGGGCGGGGGGAAGACGG - Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
962203070 3:133415826-133415848 AGGGGTGAGTAGAGGGAAGAGGG - Intronic
962203128 3:133416072-133416094 AGGGGTGAGTAGAGGGAAGATGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962487170 3:135855470-135855492 TGGGGTGGGGAGAGGGGAGAGGG - Intergenic
962684570 3:137834831-137834853 GGGTCTGGGAGGAGAGAAGAGGG - Intergenic
962841916 3:139241314-139241336 CGGGGTGGGGAGGGGGAAGGAGG - Intronic
963020103 3:140864531-140864553 AGGTTTGGGAAGAGGCATGATGG - Intergenic
963248171 3:143082119-143082141 AGGAGAGGGAAGAAGGAAGAAGG - Intergenic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
963924294 3:150935285-150935307 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
964531790 3:157676121-157676143 TGGTGTGGGGAGAAGGGAGATGG - Intronic
964935544 3:162081052-162081074 CGGGGTGGAAAGAGAAAAGAGGG + Intergenic
965102388 3:164316060-164316082 CGGTACAGGAAGAGTGAAGATGG + Intergenic
965308290 3:167096370-167096392 GGGTGGGGGAAGAGGGAATTTGG + Intergenic
966457286 3:180131919-180131941 TGGTGATGGCAGAGGGAAGAAGG + Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968887348 4:3341656-3341678 GGGTGTGGGGGGAGGGGAGATGG + Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969433902 4:7172988-7173010 CGGGCTGGGAAGTGGGAAGGTGG + Intergenic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969976303 4:11105474-11105496 CGGGGTGGGAGGAGGGGAGAAGG + Intergenic
970354720 4:15240344-15240366 TGGGGAGGGAAGAGGGAATATGG - Intergenic
971898649 4:32628866-32628888 TGGGGTGGGGAGAGGGAGGAGGG + Intergenic
972519708 4:39841795-39841817 GGGTGCGGGAAGCGGGGAGAAGG + Intronic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
974020458 4:56688027-56688049 GGGAGGGGGAAGAGGAAAGAAGG + Intergenic
974474777 4:62364368-62364390 TGGTGTTGGAAAAGGGAGGAAGG + Intergenic
974536197 4:63178975-63178997 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
974778171 4:66515430-66515452 GGGAGAGGGAAGAAGGAAGAGGG + Intergenic
975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG + Intronic
975662285 4:76699623-76699645 TTTTGTGGGAACAGGGAAGAAGG + Intronic
976433769 4:84993228-84993250 TGGTGTGGGGGGAGGGGAGAGGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
976818297 4:89175404-89175426 AGGTTGGGAAAGAGGGAAGATGG - Intergenic
977113248 4:92987442-92987464 GGGGGTGGGAGGAGGGGAGAGGG + Intronic
977280691 4:95036340-95036362 GGGGGTAGGAAGAGTGAAGATGG - Intronic
977932601 4:102764810-102764832 AGGTGTTGGGAGAGGGAAAATGG - Intergenic
978462197 4:108968571-108968593 CGGAGTGGGATGAGGAAGGAAGG - Intronic
978808500 4:112825188-112825210 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
978839169 4:113189294-113189316 CTCTGTGGGAAGAGAGAGGAGGG - Intronic
979409020 4:120351425-120351447 TGGTGTGGGAAGAAAGAAGCAGG + Intergenic
979957097 4:126967864-126967886 CTGTGTGGGATGATGCAAGAAGG + Intergenic
980084594 4:128378233-128378255 AGGAGAGAGAAGAGGGAAGAAGG + Intergenic
980395334 4:132206989-132207011 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980430421 4:132686739-132686761 TGGGGTGGGGAGAGGGAGGAGGG - Intergenic
980610013 4:135148191-135148213 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
982276050 4:153638209-153638231 GGCTGGGGGAAGAGGGAACAGGG + Intergenic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
985259188 4:188099145-188099167 CCGTGTGGGGAGAGAGAACATGG - Exonic
985620672 5:953165-953187 CGGGGTGGGAAGAGGCAGGAGGG + Intergenic
985658071 5:1142336-1142358 GGGAGAGGGAAGAGGGGAGAGGG - Intergenic
985658074 5:1142343-1142365 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
988431892 5:31128761-31128783 TGGGGTGGGAAGGAGGAAGAAGG + Intergenic
988566082 5:32320809-32320831 GGGTGTGGGAAGGAGGCAGATGG - Intergenic
988806062 5:34741807-34741829 TGGCATGGGAAGAGGGAAGAGGG + Intronic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989634679 5:43521480-43521502 GGGAGAGGGGAGAGGGAAGAGGG - Intergenic
990470465 5:56110690-56110712 TGGTGAGGGAACAGGGAAAATGG - Intronic
991262732 5:64684595-64684617 GGATGTGGGGAGAGTGAAGAGGG - Intergenic
991680517 5:69134877-69134899 CGGGGTGGGTTGGGGGAAGAGGG + Intergenic
991952996 5:71965068-71965090 TGGCCTGGGAAGAAGGAAGAAGG + Intergenic
992232459 5:74676777-74676799 CGGTGCGGGAAGGTGGAAGAAGG + Intronic
993319552 5:86456328-86456350 GGGTGTGGGATAAGGGTAGAAGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993627591 5:90244209-90244231 TGGGGTGGGAGGAGGGAGGAGGG + Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995064119 5:107841017-107841039 CTATGTGGTAAGGGGGAAGATGG + Intergenic
996403931 5:123089024-123089046 AGGGGAGGGGAGAGGGAAGAAGG - Intergenic
996831653 5:127747247-127747269 CGGGGTGGGGAGAGGGGGGAGGG - Intergenic
996879597 5:128280676-128280698 AGGTGTGGGGAGAGGGATGGTGG + Intronic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997372469 5:133370700-133370722 TGCTGTGGGAAGTGGGGAGAAGG + Intronic
997582948 5:135028625-135028647 CGGAGTGGGAAGTGGGAGGAGGG + Exonic
997980495 5:138465153-138465175 GGCTCTGGGAGGAGGGAAGAAGG + Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
999258223 5:150221787-150221809 GGGTGTAGGAAGAGGGGTGAGGG - Intronic
1000362393 5:160459969-160459991 TGGGGTGGGAGGAGGGGAGAGGG + Intergenic
1000585088 5:163087398-163087420 TGGGGTGGGGGGAGGGAAGAGGG + Intergenic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1002335872 5:178478012-178478034 GGGTGTGGGAGGAGGGAGCATGG + Intronic
1002466252 5:179410339-179410361 GGGCGTGGGAACAGGGAAGTGGG - Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002517120 5:179766830-179766852 AGTTGTGGGAAGAGGGAGGAGGG + Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1002780180 6:359340-359362 GGGTCTGGGAAGAGGGGTGAGGG + Intergenic
1003277893 6:4667847-4667869 GTCTGTGGGAAGAGAGAAGAAGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005852493 6:29832011-29832033 TGGTGTGGGAGGAGGGAGGGAGG + Intergenic
1005879315 6:30043034-30043056 GTGTGTGGGGACAGGGAAGATGG + Intergenic
1006024762 6:31139734-31139756 CTGGGTGGGAAGAGGGAACCAGG - Exonic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006446266 6:34081449-34081471 GGCTCTGGGAAGAAGGAAGAGGG + Intronic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1007363773 6:41375835-41375857 GGGTGTGAGATGAGGGAAGTTGG + Intergenic
1007530199 6:42535352-42535374 AGGTCTGAGAAGAGGAAAGAAGG - Intergenic
1007965869 6:46003330-46003352 CGGGGATGGAAGAGGGAAAAGGG - Intronic
1008242432 6:49129042-49129064 TGGTGTGGCAAGAGAGAATAAGG - Intergenic
1008354584 6:50537138-50537160 AGGTGGGGGAAGAGGGAGGGGGG - Intergenic
1008517966 6:52335987-52336009 TGCTGTGGGAAGATGGAGGAAGG - Intergenic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010568316 6:77445832-77445854 CTTTGTGGGAAGGGGGAAGGAGG + Intergenic
1011075074 6:83430711-83430733 TGGTGTGGGCAGAAGGAAGAAGG - Intronic
1011357984 6:86492260-86492282 TGGGGTGGGGAGAGGGAAGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1011726853 6:90218464-90218486 GGGTGGGGGAAGAGGAAAGAGGG - Intronic
1011784007 6:90824054-90824076 GGCTGTGGGGAGAGGTAAGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012961857 6:105630517-105630539 GGATGTGGGGTGAGGGAAGAAGG + Intergenic
1012995206 6:105965828-105965850 CGGTGAGGGTTGAGGCAAGAGGG + Intergenic
1013874451 6:114806289-114806311 AGGTGTGGGAGGAGGGGAGGAGG - Intergenic
1014030193 6:116692876-116692898 TGGGGTGGGAGGAGGGAGGAGGG - Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015519254 6:134114730-134114752 AGGTGGGGGAAGATGAAAGATGG + Intergenic
1015736105 6:136401631-136401653 TGGGGTGGGAGGAGGGGAGAGGG + Intronic
1016257519 6:142126035-142126057 GGGAGTGGGAAATGGGAAGATGG - Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017242598 6:152187509-152187531 TGGTGTGGGAAGACTGAGGAAGG - Intronic
1017521772 6:155208966-155208988 CGGGGTGGGCAGCGGGGAGAGGG - Intronic
1019018766 6:168900484-168900506 AGGGGTGAGAAGAGGGAAGCAGG + Intergenic
1019018815 6:168900664-168900686 AGGAGTGAGAAGAGGGAAGCAGG + Intergenic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1019079157 6:169417821-169417843 TGGTGAGGGAAGAGGGAGTATGG - Intergenic
1019524725 7:1475824-1475846 CGGACTGGGAAGGGGCAAGAGGG + Intronic
1019827920 7:3299961-3299983 TGGTGTGGAAAGGGGGCAGATGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020548911 7:9573096-9573118 TGGGGTGGGGAGAGGGCAGAAGG - Intergenic
1020618944 7:10495842-10495864 TGGTGTGGGAGGAGCCAAGATGG + Intergenic
1020856195 7:13427392-13427414 CGGAGAGGGAAGTGGGAAGGAGG + Intergenic
1021410594 7:20326279-20326301 GGGTGTGGGAAAAGGAGAGAAGG - Intergenic
1022010521 7:26304527-26304549 GGGTGTGGGCAGATGGGAGAGGG + Intronic
1022208526 7:28185866-28185888 GGGGGAGGGAATAGGGAAGAGGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024241664 7:47440484-47440506 GGAGGAGGGAAGAGGGAAGAGGG + Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024646748 7:51377623-51377645 CGGGATGGGAAGAGGGGAGGAGG - Intergenic
1025152906 7:56574428-56574450 TGGTGTGCGAAGGGGGAAGAGGG - Intergenic
1025796214 7:64739617-64739639 GGGAGAGGGGAGAGGGAAGAGGG + Intergenic
1025796216 7:64739624-64739646 GGGAGAGGGAAGAGGGAAGAGGG + Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026450216 7:70522446-70522468 AGGAGTGGAGAGAGGGAAGAAGG - Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026789766 7:73324082-73324104 GGAAGAGGGAAGAGGGAAGAGGG + Intronic
1027305209 7:76887718-76887740 GGGTCTGGCAGGAGGGAAGAAGG - Intergenic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028202770 7:87981533-87981555 TGGTGTGGGGATAGGGAAGAGGG + Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029099013 7:98112732-98112754 GGGTGAGGGAAGTGAGAAGAGGG + Intronic
1029584784 7:101463528-101463550 AGGGGAGGGAAGGGGGAAGAGGG - Intronic
1030288116 7:107847510-107847532 GGGAGTGGGGAGAGGGGAGAGGG - Intergenic
1031081438 7:117261172-117261194 TGGTGTAGGGAAAGGGAAGAAGG + Intergenic
1031751746 7:125583410-125583432 GGCTGGGGGAAGAGGGAAGTAGG - Intergenic
1032228202 7:130051172-130051194 CGGCGTTGGAAGATTGAAGAAGG - Intronic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032706405 7:134424035-134424057 CTGTGAGGGAAGAGGGCAGGTGG + Intergenic
1032928414 7:136636803-136636825 GGGTGAGGGGAGAGGGGAGAGGG + Intergenic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033368178 7:140687125-140687147 CGCAGCGGGCAGAGGGAAGATGG - Exonic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1034388277 7:150760096-150760118 TGGGGTGGGAGGAGGGGAGAGGG - Intergenic
1034600000 7:152241571-152241593 TGGTGTGGTAAGAGAGATGATGG - Intronic
1035018936 7:155789013-155789035 CGGTGTGGCAAGCAGGGAGAAGG - Intergenic
1035181565 7:157093113-157093135 CGGTGAGGACAGAGGTAAGATGG - Intergenic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1036426485 8:8649635-8649657 GGGTGTGAGAAAGGGGAAGAGGG - Intergenic
1036744367 8:11393595-11393617 AGGTGTGGGAACAGGGCAGATGG - Intronic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1037226549 8:16599135-16599157 TGGGGTGTGAAGTGGGAAGAAGG - Intergenic
1037429341 8:18793172-18793194 TGGGGTGGGGAGAGGGAGGAGGG + Intronic
1037819776 8:22130049-22130071 CGGGGAGGGGAGAGGGAAGGAGG + Intronic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1037987556 8:23299324-23299346 CGGTGTGGGAACCTGGAAGAGGG + Intronic
1038229337 8:25685836-25685858 GGGGGTGAGAAGTGGGAAGAGGG + Intergenic
1038340573 8:26682042-26682064 AGGAGTGGGAAGAGGGTGGAGGG - Intergenic
1039963803 8:42269659-42269681 AGGAGAGGGAAGAGGGGAGAGGG + Intergenic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1040321672 8:46312132-46312154 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1041046772 8:53895018-53895040 CTGTGCGGGGAGAGGGAAGGAGG + Intronic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043911382 8:85868425-85868447 GGGGGTGGGAGGAGGGATGAGGG - Intergenic
1044217058 8:89624657-89624679 GGGTTTGGGAGGAGGGAAGGAGG - Intergenic
1044828829 8:96225080-96225102 AGGTTTGGGAAGGGGGAAGAGGG + Intergenic
1044884979 8:96767394-96767416 CGGCTTGGGAAGAGGACAGAGGG - Intronic
1045015050 8:97994187-97994209 GGAGGGGGGAAGAGGGAAGAGGG + Intronic
1045027072 8:98097709-98097731 TGGTGTGGGAAGAAAGAAGAAGG - Intergenic
1045233291 8:100326700-100326722 AGGTCTTGGAAGAGGGAAGAAGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046527504 8:115399070-115399092 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1046610339 8:116416300-116416322 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1047051896 8:121122107-121122129 TGGGGTGGGAAGAGGGGAGAGGG - Intergenic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047711176 8:127553896-127553918 AGGTGTGGGAGCAGGTAAGATGG + Intergenic
1047739257 8:127794121-127794143 CGGTGTGGGGAAGGGTAAGAGGG + Intergenic
1048171622 8:132112166-132112188 TGGTGTGGGTAGAGGGAATGGGG - Intergenic
1048214450 8:132481543-132481565 GGAAGAGGGAAGAGGGAAGAGGG - Intergenic
1048214452 8:132481550-132481572 GGAAGAGGGAAGAGGGAAGAGGG - Intergenic
1048271658 8:133033272-133033294 TGGCAAGGGAAGAGGGAAGAAGG - Intronic
1048779351 8:137984679-137984701 TGGTGTGGGCAGAGAGAAAAGGG - Intergenic
1049491022 8:142902285-142902307 AGATGTGGGAACAGGGAAGGGGG + Intronic
1050321970 9:4461718-4461740 GGGTGAGGGAAAAGAGAAGATGG - Intergenic
1050366619 9:4879106-4879128 AGGTGAGGGAAGAGGAAAGTTGG + Intronic
1050413928 9:5394928-5394950 GGGTGAGGGAAGTGGGCAGAGGG + Intronic
1050457721 9:5849506-5849528 TGGTGTGGGAAGAGAGATGAAGG - Intergenic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1050997554 9:12239234-12239256 TGGGGTGGGGAGAGGGGAGAGGG + Intergenic
1052180611 9:25522017-25522039 AGGGGTAGGAAGAGGGAATAGGG + Intergenic
1052463502 9:28798561-28798583 TGGTTTGAGAAGAGGGAGGAAGG + Intergenic
1052976778 9:34417016-34417038 GGAGGAGGGAAGAGGGAAGAAGG - Intronic
1053054729 9:34987851-34987873 GGGTGAGGGATGAGGAAAGAAGG - Intergenic
1053163569 9:35829511-35829533 CGATGTGGGAAGCGGGGCGAGGG - Exonic
1053329322 9:37188834-37188856 AGGGGAGGGGAGAGGGAAGAGGG - Intronic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055752834 9:79526603-79526625 GGGAATGGGAAGAGGAAAGATGG + Intergenic
1055786960 9:79881541-79881563 AGGGGAGGGAAGAGGGGAGAAGG - Intergenic
1056065859 9:82933895-82933917 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1056071470 9:82991502-82991524 CTGTGTGGGACAAGGGAAGGAGG + Intronic
1056409408 9:86311576-86311598 GGGAGAGGGAAGAGGGGAGAGGG - Intronic
1056409411 9:86311583-86311605 GGGAGAGGGGAGAGGGAAGAGGG - Intronic
1056709879 9:88983840-88983862 GGGGGTGGGGAGAGGGGAGAGGG - Intergenic
1057117711 9:92541405-92541427 CGGGGTGGGGAGGGGGAAGGGGG - Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1058009860 9:99965018-99965040 GGGTGTGGGAATAAGGCAGAGGG - Intronic
1058014002 9:100009467-100009489 GGGGGTGGGGAGAGGGGAGATGG - Intronic
1058035976 9:100253560-100253582 TGGTGTGGGATGGGGGAAGCAGG - Intronic
1058146621 9:101419149-101419171 TGAAGAGGGAAGAGGGAAGAAGG - Intergenic
1058317945 9:103592583-103592605 TGGGGTGGGAGGAGGGTAGAAGG - Intergenic
1058607962 9:106743725-106743747 AGGGGAGGGAAGATGGAAGAGGG - Intergenic
1058727333 9:107816877-107816899 AGGGGTGGGAAAAGGGAGGAGGG - Intergenic
1060686873 9:125622808-125622830 CGGAGAGGGGAGAGGGGAGAGGG - Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061900886 9:133671404-133671426 TGGTGTGGAAAGAAGGAAGCCGG + Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062552430 9:137095740-137095762 AGGTGTGGAAACAGGGAACAGGG + Intronic
1203584686 Un_KI270746v1:54074-54096 TGGTGTGGTAAGAGAGATGATGG - Intergenic
1185566595 X:1099686-1099708 GGGTGTGGGCAGAGGGCAGGAGG + Intergenic
1186061917 X:5718180-5718202 CGAGGGGGGAAGAGGGAGGAGGG + Intergenic
1186071654 X:5827500-5827522 TGGGGTGGGAGGAGGCAAGAGGG - Intergenic
1186497840 X:10026034-10026056 GGGTGTAGGGAGAAGGAAGAGGG - Intronic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1188368153 X:29335273-29335295 CGGAGAGGGGAGAGGGGAGAGGG + Intronic
1188768532 X:34125951-34125973 CGGTGTGGGAGGTGGGAGGAAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189197636 X:39165680-39165702 CGGAGTGGGAGGTGGTAAGAGGG - Intergenic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190101022 X:47523385-47523407 AGGTGAGGGAAGAGGAAAGGAGG + Intergenic
1190107414 X:47570214-47570236 GGATGTGAGAAGAGGGAAGTTGG - Intronic
1190237505 X:48628311-48628333 GGGTGGAGGGAGAGGGAAGAAGG + Intergenic
1190984104 X:55485091-55485113 TGGAGGGGGAAGAGGGAAAAAGG + Exonic
1191932370 X:66388302-66388324 GGGTGGGGGAAGGGGGAAGGGGG - Intergenic
1192008925 X:67247411-67247433 TGGTGTGGGCAGATGGAAAAGGG + Intergenic
1192333474 X:70199127-70199149 GGGTTGGGGAAGAGGGGAGAAGG + Intronic
1192370432 X:70508383-70508405 GGGTGGGGGAAGAGAGCAGAGGG - Intergenic
1192657361 X:73004759-73004781 CGGTGTGTTAAAAGGGAAGGCGG - Exonic
1192664760 X:73078248-73078270 CGGTGTGTTAAAAGGGAAGGCGG + Exonic
1192848097 X:74925893-74925915 CGGGGTGGGAATGGGGAAGGGGG - Intergenic
1192903433 X:75523678-75523700 CGGGGAGGGAAAAGGGAAGGAGG - Intergenic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1194352006 X:92832683-92832705 AGGTGTGGGAAAAGGAATGAAGG - Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1194968810 X:100320082-100320104 CGTTGTGGCAAGAGGAATGAGGG - Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195318380 X:103700565-103700587 AGGGGTGGGTAGGGGGAAGAAGG + Intergenic
1195325301 X:103753436-103753458 AGGTGAGGGAAGACAGAAGAAGG - Intergenic
1195574933 X:106439009-106439031 TGGGGAGGGAAGAGGGGAGAAGG - Intergenic
1196426799 X:115578082-115578104 TGGTATAGGAAGTGGGAAGAAGG + Intronic
1199895134 X:152119986-152120008 GGGGATGGGAATAGGGAAGAGGG + Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200660314 Y:5949369-5949391 AGGTGTGGGAAAAGGAATGAAGG - Intergenic
1201146142 Y:11066624-11066646 GGGAGTGGGAGAAGGGAAGAAGG + Intergenic
1201254590 Y:12094210-12094232 TGGTGTGGGGAGAGGGGGGAGGG + Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic
1201529002 Y:14971293-14971315 TGTTGTGGGAAGAGGGGAGGGGG - Intergenic
1202013969 Y:20380564-20380586 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1202035464 Y:20629145-20629167 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic