ID: 1093960194

View in Genome Browser
Species Human (GRCh38)
Location 12:25264256-25264278
Sequence CTATTGATTAGGAGTAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093960194_1093960199 2 Left 1093960194 12:25264256-25264278 CCCAGGCTACTCCTAATCAATAG No data
Right 1093960199 12:25264281-25264303 ATATATTGTGAAGCTCTGCAGGG No data
1093960194_1093960198 1 Left 1093960194 12:25264256-25264278 CCCAGGCTACTCCTAATCAATAG No data
Right 1093960198 12:25264280-25264302 AATATATTGTGAAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093960194 Original CRISPR CTATTGATTAGGAGTAGCCT GGG (reversed) Intergenic
No off target data available for this crispr