ID: 1093963450

View in Genome Browser
Species Human (GRCh38)
Location 12:25301026-25301048
Sequence GGTGCCACACCACCACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093963443_1093963450 9 Left 1093963443 12:25300994-25301016 CCACCTCAGCCTCCCAAGTAGGT 0: 259
1: 13847
2: 29297
3: 45254
4: 116256
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963441_1093963450 10 Left 1093963441 12:25300993-25301015 CCCACCTCAGCCTCCCAAGTAGG 0: 262
1: 14836
2: 109596
3: 212485
4: 271090
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963444_1093963450 6 Left 1093963444 12:25300997-25301019 CCTCAGCCTCCCAAGTAGGTAGG 0: 98
1: 6322
2: 106306
3: 217706
4: 259924
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963446_1093963450 0 Left 1093963446 12:25301003-25301025 CCTCCCAAGTAGGTAGGACTGCA 0: 3
1: 244
2: 5435
3: 59237
4: 178674
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963449_1093963450 -4 Left 1093963449 12:25301007-25301029 CCAAGTAGGTAGGACTGCAGGTG 0: 5
1: 143
2: 3375
3: 37655
4: 113586
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963440_1093963450 29 Left 1093963440 12:25300974-25300996 CCTGGGCTCAAATGATTCTCCCA 0: 79
1: 1832
2: 14891
3: 44831
4: 124712
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data
1093963448_1093963450 -3 Left 1093963448 12:25301006-25301028 CCCAAGTAGGTAGGACTGCAGGT No data
Right 1093963450 12:25301026-25301048 GGTGCCACACCACCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093963450 Original CRISPR GGTGCCACACCACCACACCC AGG Intergenic
No off target data available for this crispr