ID: 1093964536

View in Genome Browser
Species Human (GRCh38)
Location 12:25310929-25310951
Sequence AGTTATCTGCAGAAGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093964536_1093964542 22 Left 1093964536 12:25310929-25310951 CCTGCCGTCTTCTGCAGATAACT No data
Right 1093964542 12:25310974-25310996 CTTGGCCTGTTGCTGAGCTTTGG No data
1093964536_1093964540 4 Left 1093964536 12:25310929-25310951 CCTGCCGTCTTCTGCAGATAACT No data
Right 1093964540 12:25310956-25310978 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093964536 Original CRISPR AGTTATCTGCAGAAGACGGC AGG (reversed) Intergenic
No off target data available for this crispr